EMAIL THIS PAGE TO A FRIEND

NHP2L1

NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)

67 Gene Product Result for
Synonyms: 15.5K FA-1 FA1 NHPX OTK27 SNRNP15-5 SNU13 SPAG12 SSFA1
UniProtKB ID: P55769
Gene ID:
Human(4809) Summary: Originally named because of its sequence similarity to the Saccharomyces cerevisiae NHP2 (non-histone protein 2), this protein appears to be a highly conserved nuclear protein that is a component of the [U4/U6.U5]
Mouse(20826) NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
Rat(300092) NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
naked mole-rat(101703114) NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
domestic guinea pig(100717558) NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
sheep(101112386) NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
chicken(417986) NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
cow(767931) NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
domestic cat(101081647) NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
dog(474484) NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003796 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003796 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003796 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011482 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011482 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011482 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093921 MISSION® esiRNA esiRNA human NHP2L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003796 Rosetta Predictions human pricing
NM_005008 Rosetta Predictions human pricing
NM_212515 Rosetta Predictions rat pricing
NM_011482 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031239 predicted 441
2 SASI_Hs01_00031240 predicted 345
3 SASI_Hs01_00031241 predicted 404
4 SASI_Hs01_00031242 predicted 449
5 SASI_Hs02_00304388 predicted 185
6 SASI_Hs01_00031245 predicted 561
7 SASI_Hs01_00031246 predicted 535
8 SASI_Hs01_00031247 predicted 989
9 SASI_Hs01_00031248 predicted 184
10 SASI_Hs02_00304389 predicted 181
11 SASI_Hs01_00031243 predicted 981
12 SASI_Hs01_00031244 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155740 predicted 619
2 SASI_Hs01_00155741 predicted 556
3 SASI_Hs02_00338762 predicted 617
4 SASI_Hs01_00155743 predicted 635
5 SASI_Hs01_00155745 predicted 541
6 SASI_Hs02_00338763 predicted 517
7 SASI_Hs02_00338764 predicted 556
8 SASI_Hs01_00155739 predicted 558
9 SASI_Hs01_00155746 predicted 479
10 SASI_Hs01_00155742 predicted 548
11 SASI_Hs01_00155744 predicted 570
12 SASI_Hs01_00155747 predicted 1066
13 SASI_Hs01_00155748 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212515 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270520 predicted 282
2 SASI_Rn02_00270521 predicted 257
3 SASI_Rn02_00270522 predicted 220
4 SASI_Rn02_00270523 predicted 205
5 SASI_Rn01_00044808 predicted 282
6 SASI_Rn01_00044809 predicted 379
7 SASI_Rn02_00270524 predicted 249
8 SASI_Rn02_00270525 predicted 253
9 SASI_Rn02_00270526 predicted 210
10 SASI_Rn02_00270527 predicted 210
11 SASI_Rn01_00044810 predicted 289
12 SASI_Rn01_00044811 predicted 290
13 SASI_Rn01_00044812 predicted 294
14 SASI_Rn01_00044813 predicted 290
15 SASI_Rn01_00044814 predicted 551
16 SASI_Rn01_00044815 predicted 460
17 SASI_Rn01_00044816 predicted 414
18 SASI_Rn01_00044817 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011482 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320752 predicted 757
2 SASI_Mm02_00320753 predicted 735
3 SASI_Mm02_00320754 predicted 978
4 SASI_Mm01_00023969 predicted 923
5 SASI_Mm02_00320755 predicted 862
6 SASI_Mm02_00320756 predicted 425
7 SASI_Mm02_00320757 predicted 573
8 SASI_Mm02_00320758 predicted 458
9 SASI_Mm02_00320759 predicted 699
10 SASI_Mm02_00320760 predicted 543
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003796
VALIDATED
NHP2L1 MISSION shRNA Bacterial Glycerol Stock
NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003796.1-540s1c1
Sequence:CCGGCCTGAGGTTGTGTATCATATTCTCGAGAATATGATACACAACCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003796.1-320s1c1
Sequence:CCGGGCCGCTGCTGTGTGAAGACAACTCGAGTTGTCTTCACACAGCAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003796.1-473s1c1
Sequence:CCGGGCAGTCCATTGAAAGGCTCTTCTCGAGAAGAGCCTTTCAATGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003796.1-462s1c1
Sequence:CCGGCAATCCATTCAGCAGTCCATTCTCGAGAATGGACTGCTGAATGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003796.1-188s1c1
Sequence:CCGGCGTTCAGCAGTCATGTAACTACTCGAGTAGTTACATGACTGCTGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003796.1-320s21c1
Sequence:CCGGGCCGCTGCTGTGTGAAGACAACTCGAGTTGTCTTCACACAGCAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003796.1-188s21c1
Sequence:CCGGCGTTCAGCAGTCATGTAACTACTCGAGTAGTTACATGACTGCTGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003796.1-473s21c1
Sequence:CCGGGCAGTCCATTGAAAGGCTCTTCTCGAGAAGAGCCTTTCAATGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003796.1-540s21c1
Sequence:CCGGCCTGAGGTTGTGTATCATATTCTCGAGAATATGATACACAACCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003796
VALIDATED
NHP2L1 MISSION shRNA shRNA Plasmid DNA
NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003796.1-540s1c1
Sequence:CCGGCCTGAGGTTGTGTATCATATTCTCGAGAATATGATACACAACCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003796.1-320s1c1
Sequence:CCGGGCCGCTGCTGTGTGAAGACAACTCGAGTTGTCTTCACACAGCAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003796.1-473s1c1
Sequence:CCGGGCAGTCCATTGAAAGGCTCTTCTCGAGAAGAGCCTTTCAATGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003796.1-462s1c1
Sequence:CCGGCAATCCATTCAGCAGTCCATTCTCGAGAATGGACTGCTGAATGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003796.1-188s1c1
Sequence:CCGGCGTTCAGCAGTCATGTAACTACTCGAGTAGTTACATGACTGCTGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003796.1-320s21c1
Sequence:CCGGGCCGCTGCTGTGTGAAGACAACTCGAGTTGTCTTCACACAGCAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003796.1-188s21c1
Sequence:CCGGCGTTCAGCAGTCATGTAACTACTCGAGTAGTTACATGACTGCTGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003796.1-473s21c1
Sequence:CCGGGCAGTCCATTGAAAGGCTCTTCTCGAGAAGAGCCTTTCAATGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003796.1-540s21c1
Sequence:CCGGCCTGAGGTTGTGTATCATATTCTCGAGAATATGATACACAACCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003796
VALIDATED
NHP2L1 MISSION shRNA Lentiviral Transduction Particles
NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003796.1-540s1c1
Sequence:CCGGCCTGAGGTTGTGTATCATATTCTCGAGAATATGATACACAACCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003796.1-320s1c1
Sequence:CCGGGCCGCTGCTGTGTGAAGACAACTCGAGTTGTCTTCACACAGCAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003796.1-473s1c1
Sequence:CCGGGCAGTCCATTGAAAGGCTCTTCTCGAGAAGAGCCTTTCAATGGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003796.1-462s1c1
Sequence:CCGGCAATCCATTCAGCAGTCCATTCTCGAGAATGGACTGCTGAATGGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003796.1-188s1c1
Sequence:CCGGCGTTCAGCAGTCATGTAACTACTCGAGTAGTTACATGACTGCTGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003796.1-320s21c1
Sequence:CCGGGCCGCTGCTGTGTGAAGACAACTCGAGTTGTCTTCACACAGCAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003796.1-188s21c1
Sequence:CCGGCGTTCAGCAGTCATGTAACTACTCGAGTAGTTACATGACTGCTGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003796.1-473s21c1
Sequence:CCGGGCAGTCCATTGAAAGGCTCTTCTCGAGAAGAGCCTTTCAATGGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003796.1-540s21c1
Sequence:CCGGCCTGAGGTTGTGTATCATATTCTCGAGAATATGATACACAACCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011482
VALIDATED
NHP2L1 MISSION shRNA Bacterial Glycerol Stock
NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011482.2-383s1c1
Sequence:CCGGGCCTGTTCTGTTACCATCAAACTCGAGTTTGATGGTAACAGAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011482.2-236s1c1
Sequence:CCGGAGTTACATTGTGATGGCAGCACTCGAGTGCTGCCATCACAATGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011482.2-153s1c1
Sequence:CCGGCCTTGTTCAACAGTCATGTAACTCGAGTTACATGACTGTTGAACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011482.2-430s1c1
Sequence:CCGGCCAGTCCATTCAGCAGTCTATCTCGAGATAGACTGCTGAATGGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011482.2-382s1c1
Sequence:CCGGCGCCTGTTCTGTTACCATCAACTCGAGTTGATGGTAACAGAACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011482.4-181s21c1
Sequence:CCGGCCTTGTTCAACAGTCATGTAACTCGAGTTACATGACTGTTGAACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011482.4-457s21c1
Sequence:CCGGCCAGTCCATTCAGCAGTCTATCTCGAGATAGACTGCTGAATGGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011482.4-213s21c1
Sequence:CCGGTTCGGAAAGGAGCCAATGAAGCTCGAGCTTCATTGGCTCCTTTCCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011482.4-550s21c1
Sequence:CCGGGTCTGTTAGCATGTACTATTTCTCGAGAAATAGTACATGCTAACAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011482.4-409s21c1
Sequence:CCGGCGCCTGTTCTGTTACCATCAACTCGAGTTGATGGTAACAGAACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011482
VALIDATED
NHP2L1 MISSION shRNA shRNA Plasmid DNA
NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011482.2-383s1c1
Sequence:CCGGGCCTGTTCTGTTACCATCAAACTCGAGTTTGATGGTAACAGAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011482.2-236s1c1
Sequence:CCGGAGTTACATTGTGATGGCAGCACTCGAGTGCTGCCATCACAATGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011482.2-153s1c1
Sequence:CCGGCCTTGTTCAACAGTCATGTAACTCGAGTTACATGACTGTTGAACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011482.2-430s1c1
Sequence:CCGGCCAGTCCATTCAGCAGTCTATCTCGAGATAGACTGCTGAATGGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011482.2-382s1c1
Sequence:CCGGCGCCTGTTCTGTTACCATCAACTCGAGTTGATGGTAACAGAACAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011482.4-181s21c1
Sequence:CCGGCCTTGTTCAACAGTCATGTAACTCGAGTTACATGACTGTTGAACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011482.4-457s21c1
Sequence:CCGGCCAGTCCATTCAGCAGTCTATCTCGAGATAGACTGCTGAATGGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011482.4-213s21c1
Sequence:CCGGTTCGGAAAGGAGCCAATGAAGCTCGAGCTTCATTGGCTCCTTTCCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011482.4-550s21c1
Sequence:CCGGGTCTGTTAGCATGTACTATTTCTCGAGAAATAGTACATGCTAACAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011482.4-409s21c1
Sequence:CCGGCGCCTGTTCTGTTACCATCAACTCGAGTTGATGGTAACAGAACAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011482
VALIDATED
NHP2L1 MISSION shRNA Lentiviral Transduction Particles
NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011482.2-383s1c1
Sequence:CCGGGCCTGTTCTGTTACCATCAAACTCGAGTTTGATGGTAACAGAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011482.2-236s1c1
Sequence:CCGGAGTTACATTGTGATGGCAGCACTCGAGTGCTGCCATCACAATGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011482.2-153s1c1
Sequence:CCGGCCTTGTTCAACAGTCATGTAACTCGAGTTACATGACTGTTGAACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011482.2-430s1c1
Sequence:CCGGCCAGTCCATTCAGCAGTCTATCTCGAGATAGACTGCTGAATGGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011482.2-382s1c1
Sequence:CCGGCGCCTGTTCTGTTACCATCAACTCGAGTTGATGGTAACAGAACAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011482.4-181s21c1
Sequence:CCGGCCTTGTTCAACAGTCATGTAACTCGAGTTACATGACTGTTGAACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011482.4-457s21c1
Sequence:CCGGCCAGTCCATTCAGCAGTCTATCTCGAGATAGACTGCTGAATGGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011482.4-213s21c1
Sequence:CCGGTTCGGAAAGGAGCCAATGAAGCTCGAGCTTCATTGGCTCCTTTCCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011482.4-550s21c1
Sequence:CCGGGTCTGTTAGCATGTACTATTTCTCGAGAAATAGTACATGCTAACAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011482.4-409s21c1
Sequence:CCGGCGCCTGTTCTGTTACCATCAACTCGAGTTGATGGTAACAGAACAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)