EMAIL THIS PAGE TO A FRIEND

NHS

Nance-Horan syndrome (congenital cataracts and dental anomalies)

231 Gene Product Result for
Synonyms: CTRCT40 CXN SCML1
UniProtKB ID: Q6T4R5, B7ZVX8, E2DH69, Q5J7Q0, Q5J7Q1, Q68DR5
Gene ID:
Human(4810) Summary: This gene encodes a protein containing four conserved nuclear localization signals. The encoded protein may function during the development of the eyes, teeth, and brain. Mutations in this gene have been shown to cause Nance-Horan syndrome. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2008]
Mouse(195727) Nance-Horan syndrome (human)
Rat(317494) Nance-Horan syndrome (congenital cataracts and dental anomalies)
Zebrafish(559636) Nance-Horan syndrome (congenital cataracts and dental anomalies)
Horse(100051387) Nance-Horan syndrome (congenital cataracts and dental anomalies)
cow(539895) Nance-Horan syndrome (congenital cataracts and dental anomalies)
domestic cat(101098928) Nance-Horan syndrome (congenital cataracts and dental anomalies)
chicken(418616) Nance-Horan syndrome (congenital cataracts and dental anomalies)
dog(491757) Nance-Horan syndrome (congenital cataracts and dental anomalies)
sheep(101107499) Nance-Horan syndrome (congenital cataracts and dental anomalies)
domestic guinea pig(100733205) Nance-Horan syndrome (congenital cataracts and dental anomalies)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198270 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081052 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081052 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081052 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198270 Rosetta Predictions human pricing
XM_001072360 Rosetta Predictions rat pricing
XM_228942 Rosetta Predictions rat pricing
NM_001081052 Rosetta Predictions mouse pricing
XM_112126 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140781 predicted 1438
2 SASI_Hs01_00140782 predicted 1157
3 SASI_Hs01_00140784 predicted 3688
4 SASI_Hs01_00140785 predicted 3030
5 SASI_Hs01_00140786 predicted 1388
6 SASI_Hs02_00371817 predicted 1770
7 SASI_Hs02_00371818 predicted 4725
8 SASI_Hs01_00140789 predicted 4580
9 SASI_Hs02_00371819 predicted 4848
10 SASI_Hs01_00140790 predicted 1423
11 SASI_Hs01_00140783 predicted 3454
12 SASI_Hs01_00140787 predicted 3639
13 SASI_Hs01_00140788 predicted 2625
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338836 predicted 4016
2 SASI_Rn02_00338837 predicted 3933
3 SASI_Rn02_00338838 predicted 3010
4 SASI_Rn02_00338839 predicted 3729
5 SASI_Rn02_00338840 predicted 3839
6 SASI_Rn02_00338841 predicted 4073
7 SASI_Rn02_00338842 predicted 5243
8 SASI_Rn02_00338843 predicted 3874
9 SASI_Rn02_00338844 predicted 2330
10 SASI_Rn02_00338845 predicted 4377
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385665 predicted 3720
2 SASI_Rn02_00385666 predicted 3644
3 SASI_Rn02_00385667 predicted 3772
4 SASI_Rn02_00385668 predicted 3441
5 SASI_Rn02_00385669 predicted 3556
6 SASI_Rn02_00385670 predicted 4569
7 SASI_Rn02_00385671 predicted 3782
8 SASI_Rn02_00385672 predicted 4950
9 SASI_Rn02_00385673 predicted 4358
10 SASI_Rn02_00385674 predicted 3587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294701 predicted 4521
2 SASI_Mm02_00294702 predicted 3401
3 SASI_Mm02_00294703 predicted 2878
4 SASI_Mm02_00294704 predicted 2670
5 SASI_Mm02_00294705 predicted 3739
6 SASI_Mm02_00294706 predicted 2381
7 SASI_Mm02_00294707 predicted 5381
8 SASI_Mm02_00294708 predicted 3244
9 SASI_Mm02_00294709 predicted 3545
10 SASI_Mm02_00294710 predicted 4040
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_112126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269306 predicted 4519
2 SASI_Mm01_00269307 predicted 3517
3 SASI_Mm01_00269308 predicted 3599
4 SASI_Mm01_00269309 predicted 3405
5 SASI_Mm01_00269310 predicted 2679
6 SASI_Mm01_00269311 predicted 3738
7 SASI_Mm01_00269312 predicted 4046
8 SASI_Mm01_00269313 predicted 2387
9 SASI_Mm01_00269314 predicted 5389
10 SASI_Mm01_00269315 predicted 3253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198270
VALIDATED
NHS MISSION shRNA Bacterial Glycerol Stock
Nance-Horan syndrome (congenital cataracts and dental anomalies)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198270.2-3990s21c1
Sequence:CCGGAGCAGTCTTCTAGATTCAAATCTCGAGATTTGAATCTAGAAGACTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198270.2-3508s21c1
Sequence:CCGGACCTTGAACTTCCAATTATACCTCGAGGTATAATTGGAAGTTCAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198270.2-5399s21c1
Sequence:CCGGTAGACATTCTTGATTAGTTTCCTCGAGGAAACTAATCAAGAATGTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198270.2-5454s21c1
Sequence:CCGGCTTTAGCATAGTTTGATTTACCTCGAGGTAAATCAAACTATGCTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_198270.2-6300s1c1
Sequence:CCGGCCAGGTTCTTAAACTAACAAACTCGAGTTTGTTAGTTTAAGAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_198270.2-3048s1c1
Sequence:CCGGCCTCAGTTAGATGCTTCGGATCTCGAGATCCGAAGCATCTAACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198270.2-4117s1c1
Sequence:CCGGGCCCAAATGATTTGGATGGTACTCGAGTACCATCCAAATCATTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_198270.2-4119s1c1
Sequence:CCGGCCAAATGATTTGGATGGTAAACTCGAGTTTACCATCCAAATCATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_198270.2-4506s1c1
Sequence:CCGGCCGAGTGATGACTCCATCATTCTCGAGAATGATGGAGTCATCACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198270
VALIDATED
NHS MISSION shRNA shRNA Plasmid DNA
Nance-Horan syndrome (congenital cataracts and dental anomalies)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198270.2-3990s21c1
Sequence:CCGGAGCAGTCTTCTAGATTCAAATCTCGAGATTTGAATCTAGAAGACTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198270.2-3508s21c1
Sequence:CCGGACCTTGAACTTCCAATTATACCTCGAGGTATAATTGGAAGTTCAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198270.2-5399s21c1
Sequence:CCGGTAGACATTCTTGATTAGTTTCCTCGAGGAAACTAATCAAGAATGTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198270.2-5454s21c1
Sequence:CCGGCTTTAGCATAGTTTGATTTACCTCGAGGTAAATCAAACTATGCTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_198270.2-6300s1c1
Sequence:CCGGCCAGGTTCTTAAACTAACAAACTCGAGTTTGTTAGTTTAAGAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_198270.2-3048s1c1
Sequence:CCGGCCTCAGTTAGATGCTTCGGATCTCGAGATCCGAAGCATCTAACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198270.2-4117s1c1
Sequence:CCGGGCCCAAATGATTTGGATGGTACTCGAGTACCATCCAAATCATTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_198270.2-4119s1c1
Sequence:CCGGCCAAATGATTTGGATGGTAAACTCGAGTTTACCATCCAAATCATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_198270.2-4506s1c1
Sequence:CCGGCCGAGTGATGACTCCATCATTCTCGAGAATGATGGAGTCATCACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198270
VALIDATED
NHS MISSION shRNA Lentiviral Transduction Particles
Nance-Horan syndrome (congenital cataracts and dental anomalies)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198270.2-3990s21c1
Sequence:CCGGAGCAGTCTTCTAGATTCAAATCTCGAGATTTGAATCTAGAAGACTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198270.2-3508s21c1
Sequence:CCGGACCTTGAACTTCCAATTATACCTCGAGGTATAATTGGAAGTTCAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198270.2-5399s21c1
Sequence:CCGGTAGACATTCTTGATTAGTTTCCTCGAGGAAACTAATCAAGAATGTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198270.2-5454s21c1
Sequence:CCGGCTTTAGCATAGTTTGATTTACCTCGAGGTAAATCAAACTATGCTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_198270.2-6300s1c1
Sequence:CCGGCCAGGTTCTTAAACTAACAAACTCGAGTTTGTTAGTTTAAGAACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_198270.2-3048s1c1
Sequence:CCGGCCTCAGTTAGATGCTTCGGATCTCGAGATCCGAAGCATCTAACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198270.2-4117s1c1
Sequence:CCGGGCCCAAATGATTTGGATGGTACTCGAGTACCATCCAAATCATTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_198270.2-4119s1c1
Sequence:CCGGCCAAATGATTTGGATGGTAAACTCGAGTTTACCATCCAAATCATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_198270.2-4506s1c1
Sequence:CCGGCCGAGTGATGACTCCATCATTCTCGAGAATGATGGAGTCATCACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081052
NHS MISSION shRNA Bacterial Glycerol Stock
Nance-Horan syndrome (congenital cataracts and dental anomalies)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081052.1-3205s21c1
Sequence:CCGGCCTTACAGATCCTTATCTAATCTCGAGATTAGATAAGGATCTGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081052.1-5514s21c1
Sequence:CCGGTTGATTTGTTCGATCTCATTCCTCGAGGAATGAGATCGAACAAATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081052.1-4642s21c1
Sequence:CCGGCGAACCACTGAGGACCTATTTCTCGAGAAATAGGTCCTCAGTGGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081052.1-2666s21c1
Sequence:CCGGTGGACACTGAAGGATACTATACTCGAGTATAGTATCCTTCAGTGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081052.1-4346s21c1
Sequence:CCGGATAAGCATCAGCGTGTTATAACTCGAGTTATAACACGCTGATGCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081052
NHS MISSION shRNA shRNA Plasmid DNA
Nance-Horan syndrome (congenital cataracts and dental anomalies)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081052.1-3205s21c1
Sequence:CCGGCCTTACAGATCCTTATCTAATCTCGAGATTAGATAAGGATCTGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081052.1-5514s21c1
Sequence:CCGGTTGATTTGTTCGATCTCATTCCTCGAGGAATGAGATCGAACAAATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081052.1-4642s21c1
Sequence:CCGGCGAACCACTGAGGACCTATTTCTCGAGAAATAGGTCCTCAGTGGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081052.1-2666s21c1
Sequence:CCGGTGGACACTGAAGGATACTATACTCGAGTATAGTATCCTTCAGTGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081052.1-4346s21c1
Sequence:CCGGATAAGCATCAGCGTGTTATAACTCGAGTTATAACACGCTGATGCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081052
NHS MISSION shRNA Lentiviral Transduction Particles
Nance-Horan syndrome (congenital cataracts and dental anomalies)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081052.1-3205s21c1
Sequence:CCGGCCTTACAGATCCTTATCTAATCTCGAGATTAGATAAGGATCTGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081052.1-5514s21c1
Sequence:CCGGTTGATTTGTTCGATCTCATTCCTCGAGGAATGAGATCGAACAAATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081052.1-4642s21c1
Sequence:CCGGCGAACCACTGAGGACCTATTTCTCGAGAAATAGGTCCTCAGTGGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081052.1-2666s21c1
Sequence:CCGGTGGACACTGAAGGATACTATACTCGAGTATAGTATCCTTCAGTGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081052.1-4346s21c1
Sequence:CCGGATAAGCATCAGCGTGTTATAACTCGAGTTATAACACGCTGATGCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)