EMAIL THIS PAGE TO A FRIEND

NHSL1

NHS-like 1

181 Gene Product Result for
Synonyms: C6orf63
UniProtKB ID: Q5SYE7, Q3ZCS5, Q5SYE8, Q9P2J0
Gene ID:
Mouse(215819) NHS-like 1
Rat(308631) NHS-like 1
chicken(421680) NHS-like 1
dog(476219) NHS-like 1
Horse(100073200) NHS-like 1
cow(517882) NHS-like 1
sheep(101114450) NHS-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001144060 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001144060 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001144060 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173390 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173390 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173390 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU064891 MISSION® esiRNA esiRNA targeting mouse Nhsl1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001723403 Rosetta Predictions human pricing
XM_496826 Rosetta Predictions human pricing
XM_933674 Rosetta Predictions human pricing
XM_933675 Rosetta Predictions human pricing
XM_933677 Rosetta Predictions human pricing
XM_941807 Rosetta Predictions human pricing
XM_218663 Rosetta Predictions rat pricing
XR_008811 Rosetta Predictions rat pricing
NM_173390 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00455182 predicted 1785
2 SASI_Hs02_00455183 predicted 983
3 SASI_Hs02_00455184 predicted 417
4 SASI_Hs02_00455185 predicted 799
5 SASI_Hs02_00455186 predicted 3660
6 SASI_Hs02_00455187 predicted 1590
7 SASI_Hs02_00455188 predicted 3418
8 SASI_Hs02_00455189 predicted 717
9 SASI_Hs02_00455190 predicted 2616
10 SASI_Hs02_00455191 predicted 4386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282085 predicted 986
2 SASI_Hs01_00282086 predicted 413
3 SASI_Hs01_00282087 predicted 1220
4 SASI_Hs01_00282088 predicted 795
5 SASI_Hs01_00282089 predicted 3666
6 SASI_Hs01_00282090 predicted 1595
7 SASI_Hs02_00480057 predicted 3425
8 SASI_Hs01_00282091 predicted 718
9 SASI_Hs01_00282092 predicted 2620
10 SASI_Hs01_00282093 predicted 4393
11 SASI_Hs01_00282084 predicted 1772
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296549 predicted 2250
2 SASI_Hs01_00296550 predicted 2330
3 SASI_Hs01_00296551 predicted 2206
4 SASI_Hs01_00296552 predicted 2033
5 SASI_Hs01_00296553 predicted 2329
6 SASI_Hs01_00296554 predicted 2033
7 SASI_Hs01_00296555 predicted 1343
8 SASI_Hs01_00296556 predicted 2201
9 SASI_Hs01_00296557 predicted 1358
10 SASI_Hs01_00296558 predicted 2205
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271795 predicted 1308
2 SASI_Hs01_00271796 predicted 2541
3 SASI_Hs01_00271797 predicted 1876
4 SASI_Hs01_00271798 predicted 2547
5 SASI_Hs01_00271799 predicted 1558
6 SASI_Hs01_00271800 predicted 2013
7 SASI_Hs01_00271801 predicted 1266
8 SASI_Hs01_00271802 predicted 1562
9 SASI_Hs01_00271803 predicted 1564
10 SASI_Hs01_00271804 predicted 2042
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283340 predicted 203
2 SASI_Hs01_00283341 predicted 306
3 SASI_Hs01_00283342 predicted 273
4 SASI_Hs01_00283343 predicted 239
5 SASI_Hs01_00283344 predicted 197
6 SASI_Hs01_00283345 predicted 203
7 SASI_Hs01_00283346 predicted 270
8 SASI_Hs01_00283347 predicted 214
9 SASI_Hs01_00283348 predicted 205
10 SASI_Hs01_00283349 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485107 predicted 1790
2 SASI_Hs02_00485108 predicted 980
3 SASI_Hs02_00485109 predicted 412
4 SASI_Hs02_00485110 predicted 799
5 SASI_Hs02_00485111 predicted 3663
6 SASI_Hs02_00485112 predicted 1598
7 SASI_Hs02_00485113 predicted 3422
8 SASI_Hs02_00485114 predicted 718
9 SASI_Hs02_00485115 predicted 2617
10 SASI_Hs02_00485116 predicted 4387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218663 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127065 predicted 5671
2 SASI_Rn01_00127066 predicted 4664
3 SASI_Rn01_00127067 predicted 1661
4 SASI_Rn01_00127068 predicted 1932
5 SASI_Rn01_00127069 predicted 4875
6 SASI_Rn01_00127070 predicted 2432
7 SASI_Rn01_00127071 predicted 4544
8 SASI_Rn01_00127072 predicted 444
9 SASI_Rn01_00127073 predicted 3793
10 SASI_Rn01_00127074 predicted 3280
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008811 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00189746 predicted 3429
2 SASI_Rn01_00189747 predicted 4317
3 SASI_Rn01_00189749 predicted 3414
4 SASI_Rn01_00189750 predicted 2428
5 SASI_Rn01_00189751 predicted 1503
6 SASI_Rn01_00189752 predicted 2635
7 SASI_Rn02_00417981 predicted 3284
8 SASI_Rn01_00189753 predicted 3663
9 SASI_Rn01_00189754 predicted 3438
10 SASI_Rn01_00189755 predicted 2305
11 SASI_Rn01_00189748 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345214 predicted 3941
2 SASI_Mm01_00090033 predicted 4723
3 SASI_Mm02_00345215 predicted 2386
4 SASI_Mm02_00345216 predicted 2108
5 SASI_Mm02_00345217 predicted 3169
6 SASI_Mm02_00345218 predicted 1747
7 SASI_Mm02_00345219 predicted 797
8 SASI_Mm02_00345220 predicted 2833
9 SASI_Mm02_00345221 predicted 4701
10 SASI_Mm01_00090036 predicted 4849
11 SASI_Mm01_00090031 predicted 274
12 SASI_Mm01_00090032 predicted 285
13 SASI_Mm01_00090034 predicted 980
14 SASI_Mm01_00090035 predicted 203
15 SASI_Mm01_00090037 predicted 924
16 SASI_Mm01_00090038 predicted 667
17 SASI_Mm01_00090039 predicted 442
18 SASI_Mm01_00090040 predicted 395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144060
VALIDATED
NHSL1 MISSION shRNA Bacterial Glycerol Stock
NHS-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144060.1-1757s21c1
Sequence:CCGGCAAGAGTGAATCTAGTTATTCCTCGAGGAATAACTAGATTCACTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144060.1-1690s21c1
Sequence:CCGGCCCAAGCTATGCCGTATAATTCTCGAGAATTATACGGCATAGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144060.1-558s21c1
Sequence:CCGGAGTGACTTCTCCGACCTTAATCTCGAGATTAAGGTCGGAGAAGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144060.1-5370s21c1
Sequence:CCGGCTCTGGTCTAGGCGGTAATTGCTCGAGCAATTACCGCCTAGACCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144060.1-656s21c1
Sequence:CCGGGGCTGACGTGGTGCCTATTAACTCGAGTTAATAGGCACCACGTCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144060
VALIDATED
NHSL1 MISSION shRNA shRNA Plasmid DNA
NHS-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144060.1-1757s21c1
Sequence:CCGGCAAGAGTGAATCTAGTTATTCCTCGAGGAATAACTAGATTCACTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144060.1-1690s21c1
Sequence:CCGGCCCAAGCTATGCCGTATAATTCTCGAGAATTATACGGCATAGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144060.1-558s21c1
Sequence:CCGGAGTGACTTCTCCGACCTTAATCTCGAGATTAAGGTCGGAGAAGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144060.1-5370s21c1
Sequence:CCGGCTCTGGTCTAGGCGGTAATTGCTCGAGCAATTACCGCCTAGACCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144060.1-656s21c1
Sequence:CCGGGGCTGACGTGGTGCCTATTAACTCGAGTTAATAGGCACCACGTCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144060
VALIDATED
NHSL1 MISSION shRNA Lentiviral Transduction Particles
NHS-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144060.1-1757s21c1
Sequence:CCGGCAAGAGTGAATCTAGTTATTCCTCGAGGAATAACTAGATTCACTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144060.1-1690s21c1
Sequence:CCGGCCCAAGCTATGCCGTATAATTCTCGAGAATTATACGGCATAGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144060.1-558s21c1
Sequence:CCGGAGTGACTTCTCCGACCTTAATCTCGAGATTAAGGTCGGAGAAGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144060.1-5370s21c1
Sequence:CCGGCTCTGGTCTAGGCGGTAATTGCTCGAGCAATTACCGCCTAGACCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144060.1-656s21c1
Sequence:CCGGGGCTGACGTGGTGCCTATTAACTCGAGTTAATAGGCACCACGTCAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173390
VALIDATED
NHSL1 MISSION shRNA Bacterial Glycerol Stock
NHS-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173390.2-2598s1c1
Sequence:CCGGCCGCAAATGATGACCTGACATCTCGAGATGTCAGGTCATCATTTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173390.2-270s1c1
Sequence:CCGGGAAGACCTGTTTGCAGCCATTCTCGAGAATGGCTGCAAACAGGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173390.3-801s21c1
Sequence:CCGGGATGATGAGAACTGGATATACCTCGAGGTATATCCAGTTCTCATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173390.3-6725s21c1
Sequence:CCGGTAGAGTGTACAACCGTATTTACTCGAGTAAATACGGTTGTACACTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173390.3-3962s21c1
Sequence:CCGGTTTCCTCAAATCCCGAAATAGCTCGAGCTATTTCGGGATTTGAGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173390.3-2928s21c1
Sequence:CCGGAGTAGCGTCAAGTCGGAATACCTCGAGGTATTCCGACTTGACGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173390.2-1815s1c1
Sequence:CCGGGCTGGATTTGTTTCCTGCTTACTCGAGTAAGCAGGAAACAAATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173390.3-1021s21c1
Sequence:CCGGGCCGAAGTTCTCAGTACTATTCTCGAGAATAGTACTGAGAACTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173390
VALIDATED
NHSL1 MISSION shRNA shRNA Plasmid DNA
NHS-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173390.2-2598s1c1
Sequence:CCGGCCGCAAATGATGACCTGACATCTCGAGATGTCAGGTCATCATTTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173390.2-270s1c1
Sequence:CCGGGAAGACCTGTTTGCAGCCATTCTCGAGAATGGCTGCAAACAGGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173390.3-801s21c1
Sequence:CCGGGATGATGAGAACTGGATATACCTCGAGGTATATCCAGTTCTCATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173390.3-6725s21c1
Sequence:CCGGTAGAGTGTACAACCGTATTTACTCGAGTAAATACGGTTGTACACTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173390.3-3962s21c1
Sequence:CCGGTTTCCTCAAATCCCGAAATAGCTCGAGCTATTTCGGGATTTGAGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173390.3-2928s21c1
Sequence:CCGGAGTAGCGTCAAGTCGGAATACCTCGAGGTATTCCGACTTGACGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173390.2-1815s1c1
Sequence:CCGGGCTGGATTTGTTTCCTGCTTACTCGAGTAAGCAGGAAACAAATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173390.3-1021s21c1
Sequence:CCGGGCCGAAGTTCTCAGTACTATTCTCGAGAATAGTACTGAGAACTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173390
VALIDATED
NHSL1 MISSION shRNA Lentiviral Transduction Particles
NHS-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173390.2-2598s1c1
Sequence:CCGGCCGCAAATGATGACCTGACATCTCGAGATGTCAGGTCATCATTTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173390.2-270s1c1
Sequence:CCGGGAAGACCTGTTTGCAGCCATTCTCGAGAATGGCTGCAAACAGGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173390.3-801s21c1
Sequence:CCGGGATGATGAGAACTGGATATACCTCGAGGTATATCCAGTTCTCATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173390.3-6725s21c1
Sequence:CCGGTAGAGTGTACAACCGTATTTACTCGAGTAAATACGGTTGTACACTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173390.3-3962s21c1
Sequence:CCGGTTTCCTCAAATCCCGAAATAGCTCGAGCTATTTCGGGATTTGAGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173390.3-2928s21c1
Sequence:CCGGAGTAGCGTCAAGTCGGAATACCTCGAGGTATTCCGACTTGACGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173390.2-1815s1c1
Sequence:CCGGGCTGGATTTGTTTCCTGCTTACTCGAGTAAGCAGGAAACAAATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173390.3-1021s21c1
Sequence:CCGGGCCGAAGTTCTCAGTACTATTCTCGAGAATAGTACTGAGAACTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)