EMAIL THIS PAGE TO A FRIEND

NHSL2

NHS-like 2

53 Gene Product Result for
UniProtKB ID: Q5HYW2, B2RN94
Gene ID:
Mouse(100042480) NHS-like 2
Rat(317253) NHS-like 2
chicken(422133) NHS-like 2
cow(513680) NHS-like 2
dog(491954) NHS-like 2
Horse(100052101) NHS-like 2
sheep(101102704) NHS-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001013627 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013627 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013627 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104271 MISSION® esiRNA esiRNA human NHSL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013627 Rosetta Predictions human pricing
XM_001070369 Rosetta Predictions rat pricing
XM_228547 Rosetta Predictions rat pricing
XM_001478287 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145049 predicted 1425
2 SASI_Hs01_00145051 predicted 3027
3 SASI_Hs02_00306397 predicted 3160
4 SASI_Hs01_00145053 predicted 1540
5 SASI_Hs01_00145054 predicted 2520
6 SASI_Hs01_00145055 predicted 1635
7 SASI_Hs01_00145056 predicted 2152
8 SASI_Hs02_00306398 predicted 2826
9 SASI_Hs01_00145057 predicted 2727
10 SASI_Hs01_00145058 predicted 2016
11 SASI_Hs01_00145050 predicted 2038
12 SASI_Hs01_00145052 predicted 3113
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331416 predicted 1794
2 SASI_Rn02_00331417 predicted 2701
3 SASI_Rn02_00331418 predicted 1948
4 SASI_Rn02_00331419 predicted 786
5 SASI_Rn02_00331420 predicted 2991
6 SASI_Rn02_00331421 predicted 1462
7 SASI_Rn02_00331422 predicted 1832
8 SASI_Rn02_00331423 predicted 1992
9 SASI_Rn02_00331424 predicted 2577
10 SASI_Rn02_00331425 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385220 predicted 2818
2 SASI_Rn02_00385221 predicted 2697
3 SASI_Rn02_00385222 predicted 867
4 SASI_Rn02_00385223 predicted 778
5 SASI_Rn02_00385224 predicted 2263
6 SASI_Rn02_00385225 predicted 2990
7 SASI_Rn02_00385226 predicted 2213
8 SASI_Rn02_00385227 predicted 2575
9 SASI_Rn02_00385228 predicted 1161
10 SASI_Rn02_00385229 predicted 2545
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478287 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00401559 predicted 1224
2 SASI_Mm02_00401560 predicted 1529
3 SASI_Mm02_00401561 predicted 774
4 SASI_Mm02_00401562 predicted 1848
5 SASI_Mm02_00401563 predicted 1272
6 SASI_Mm02_00401564 predicted 1825
7 SASI_Mm02_00401565 predicted 890
8 SASI_Mm02_00401566 predicted 1917
9 SASI_Mm02_00401567 predicted 390
10 SASI_Mm02_00401568 predicted 394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163610
NHSL2 MISSION shRNA Bacterial Glycerol Stock
NHS-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163610.1-1898s21c1
Sequence:CCGGGAAGTGTCTCACTCGTCAAAGCTCGAGCTTTGACGAGTGAGACACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163610.1-2866s21c1
Sequence:CCGGCCACTAACTTCTCCTACTATGCTCGAGCATAGTAGGAGAAGTTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163610.1-3774s21c1
Sequence:CCGGCCCTCTGGCTCGAAGGATTATCTCGAGATAATCCTTCGAGCCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163610.1-2473s21c1
Sequence:CCGGTGCAAGTCACGGTTATCATTTCTCGAGAAATGATAACCGTGACTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163610.1-1500s21c1
Sequence:CCGGGCTCTTTGTCACCCGTGATAACTCGAGTTATCACGGGTGACAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163610
NHSL2 MISSION shRNA shRNA Plasmid DNA
NHS-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163610.1-1898s21c1
Sequence:CCGGGAAGTGTCTCACTCGTCAAAGCTCGAGCTTTGACGAGTGAGACACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163610.1-2866s21c1
Sequence:CCGGCCACTAACTTCTCCTACTATGCTCGAGCATAGTAGGAGAAGTTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163610.1-3774s21c1
Sequence:CCGGCCCTCTGGCTCGAAGGATTATCTCGAGATAATCCTTCGAGCCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163610.1-2473s21c1
Sequence:CCGGTGCAAGTCACGGTTATCATTTCTCGAGAAATGATAACCGTGACTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163610.1-1500s21c1
Sequence:CCGGGCTCTTTGTCACCCGTGATAACTCGAGTTATCACGGGTGACAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163610
NHSL2 MISSION shRNA Lentiviral Transduction Particles
NHS-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163610.1-1898s21c1
Sequence:CCGGGAAGTGTCTCACTCGTCAAAGCTCGAGCTTTGACGAGTGAGACACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163610.1-2866s21c1
Sequence:CCGGCCACTAACTTCTCCTACTATGCTCGAGCATAGTAGGAGAAGTTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163610.1-3774s21c1
Sequence:CCGGCCCTCTGGCTCGAAGGATTATCTCGAGATAATCCTTCGAGCCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163610.1-2473s21c1
Sequence:CCGGTGCAAGTCACGGTTATCATTTCTCGAGAAATGATAACCGTGACTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163610.1-1500s21c1
Sequence:CCGGGCTCTTTGTCACCCGTGATAACTCGAGTTATCACGGGTGACAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013627
NHSL2 MISSION shRNA Bacterial Glycerol Stock
NHS-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013627.1-1832s1c1
Sequence:CCGGCAAGAGTATCTCACTTAGGAACTCGAGTTCCTAAGTGAGATACTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013627.1-1300s1c1
Sequence:CCGGCTTGCAATGGACCTACAGAATCTCGAGATTCTGTAGGTCCATTGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013627.1-2457s1c1
Sequence:CCGGCCCAAGTCACGGCTATCATTTCTCGAGAAATGATAGCCGTGACTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013627.1-3802s1c1
Sequence:CCGGCAGACTGAGTTCAAGTGCCATCTCGAGATGGCACTTGAACTCAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013627.1-2434s1c1
Sequence:CCGGCGACGTCACCAATGGAGAAATCTCGAGATTTCTCCATTGGTGACGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013627.1-3325s1c1
Sequence:CCGGCACTTGGTCAAAGGGTGACTTCTCGAGAAGTCACCCTTTGACCAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013627.1-2835s1c1
Sequence:CCGGGTTCCTGAGGAGTATGCACTACTCGAGTAGTGCATACTCCTCAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013627.1-3636s1c1
Sequence:CCGGGTGCTGAGATAATGAAATCAACTCGAGTTGATTTCATTATCTCAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013627.1-2839s1c1
Sequence:CCGGCTGAGGAGTATGCACTAACTTCTCGAGAAGTTAGTGCATACTCCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013627
NHSL2 MISSION shRNA shRNA Plasmid DNA
NHS-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013627.1-1832s1c1
Sequence:CCGGCAAGAGTATCTCACTTAGGAACTCGAGTTCCTAAGTGAGATACTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013627.1-1300s1c1
Sequence:CCGGCTTGCAATGGACCTACAGAATCTCGAGATTCTGTAGGTCCATTGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013627.1-2457s1c1
Sequence:CCGGCCCAAGTCACGGCTATCATTTCTCGAGAAATGATAGCCGTGACTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013627.1-3802s1c1
Sequence:CCGGCAGACTGAGTTCAAGTGCCATCTCGAGATGGCACTTGAACTCAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013627.1-2434s1c1
Sequence:CCGGCGACGTCACCAATGGAGAAATCTCGAGATTTCTCCATTGGTGACGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013627.1-3325s1c1
Sequence:CCGGCACTTGGTCAAAGGGTGACTTCTCGAGAAGTCACCCTTTGACCAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013627.1-2835s1c1
Sequence:CCGGGTTCCTGAGGAGTATGCACTACTCGAGTAGTGCATACTCCTCAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013627.1-3636s1c1
Sequence:CCGGGTGCTGAGATAATGAAATCAACTCGAGTTGATTTCATTATCTCAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013627.1-2839s1c1
Sequence:CCGGCTGAGGAGTATGCACTAACTTCTCGAGAAGTTAGTGCATACTCCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013627
NHSL2 MISSION shRNA Lentiviral Transduction Particles
NHS-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013627.1-1832s1c1
Sequence:CCGGCAAGAGTATCTCACTTAGGAACTCGAGTTCCTAAGTGAGATACTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013627.1-1300s1c1
Sequence:CCGGCTTGCAATGGACCTACAGAATCTCGAGATTCTGTAGGTCCATTGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013627.1-2457s1c1
Sequence:CCGGCCCAAGTCACGGCTATCATTTCTCGAGAAATGATAGCCGTGACTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013627.1-3802s1c1
Sequence:CCGGCAGACTGAGTTCAAGTGCCATCTCGAGATGGCACTTGAACTCAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013627.1-2434s1c1
Sequence:CCGGCGACGTCACCAATGGAGAAATCTCGAGATTTCTCCATTGGTGACGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013627.1-3325s1c1
Sequence:CCGGCACTTGGTCAAAGGGTGACTTCTCGAGAAGTCACCCTTTGACCAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013627.1-2835s1c1
Sequence:CCGGGTTCCTGAGGAGTATGCACTACTCGAGTAGTGCATACTCCTCAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013627.1-3636s1c1
Sequence:CCGGGTGCTGAGATAATGAAATCAACTCGAGTTGATTTCATTATCTCAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013627.1-2839s1c1
Sequence:CCGGCTGAGGAGTATGCACTAACTTCTCGAGAAGTTAGTGCATACTCCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)