EMAIL THIS PAGE TO A FRIEND

NID1

nidogen 1

148 Gene Product Result for
Synonyms: NID
UniProtKB ID: P14543, Q14942, Q59FL2, Q5TAF2, Q5TAF3, Q86XD7
Gene ID:
Human(4811) Summary: This gene encodes a member of the nidogen family of basement membrane glycoproteins. The protein interacts with several other components of basement membranes, and may play a role in cell interactions with the extracellular matrix. [provided by RefSeq, Jul 2008]
Mouse(18073) nidogen 1
Rat(25494) nidogen 1
chicken(395531) nidogen 1
cow(534319) nidogen 1
Horse(100058173) nidogen 1
dog(488958) nidogen 1
sheep(101117471) nidogen 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010917 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010917 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010917 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002508 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002508 Rosetta Predictions human pricing
XM_001054079 Rosetta Predictions rat pricing
XM_213954 Rosetta Predictions rat pricing
NM_010917 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171909 predicted 796
2 SASI_Hs01_00171910 predicted 2380
3 SASI_Hs02_00333972 predicted 3815
4 SASI_Hs01_00171911 predicted 1683
5 SASI_Hs01_00171912 predicted 3881
6 SASI_Hs01_00171913 predicted 3209
7 SASI_Hs01_00171914 predicted 1365
8 SASI_Hs02_00333973 predicted 3030
9 SASI_Hs01_00171915 predicted 2222
10 SASI_Hs01_00171916 predicted 3724
11 SASI_Hs01_00171917 predicted 1536
12 SASI_Hs01_00171918 predicted 3797
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274647 predicted 2415
2 SASI_Rn02_00274648 predicted 3297
3 SASI_Rn02_00274649 predicted 849
4 SASI_Rn02_00274650 predicted 1778
5 SASI_Rn02_00274651 predicted 2428
6 SASI_Rn02_00274652 predicted 334
7 SASI_Rn02_00274653 predicted 2217
8 SASI_Rn02_00274654 predicted 1821
9 SASI_Rn02_00274655 predicted 2778
10 SASI_Rn02_00274656 predicted 3392
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213954 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375036 predicted 2416
2 SASI_Rn02_00375037 predicted 3382
3 SASI_Rn02_00375038 predicted 845
4 SASI_Rn02_00375039 predicted 1779
5 SASI_Rn02_00375040 predicted 1115
6 SASI_Rn02_00375041 predicted 2425
7 SASI_Rn02_00375042 predicted 337
8 SASI_Rn02_00375043 predicted 2219
9 SASI_Rn02_00375044 predicted 1817
10 SASI_Rn02_00375045 predicted 2771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095744 predicted 2365
2 SASI_Mm01_00095745 predicted 736
3 SASI_Mm01_00095746 predicted 802
4 SASI_Mm01_00095747 predicted 358
5 SASI_Mm01_00095748 predicted 281
6 SASI_Mm01_00095749 predicted 1704
7 SASI_Mm01_00095750 predicted 1783
8 SASI_Mm01_00095752 predicted 3536
9 SASI_Mm02_00319653 predicted 2922
10 SASI_Mm01_00095753 predicted 3430
11 SASI_Mm01_00095751 predicted 1552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010917
VALIDATED
NID1 MISSION shRNA Bacterial Glycerol Stock
nidogen 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010917.2-2206s21c1
Sequence:CCGGCGGGCAGACTTGCTATGATATCTCGAGATATCATAGCAAGTCTGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010917.2-2918s21c1
Sequence:CCGGCCAGGGACACACTTACTCTTTCTCGAGAAAGAGTAAGTGTGTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010917.2-3625s21c1
Sequence:CCGGCCTTGCTATATCCAAAGAGATCTCGAGATCTCTTTGGATATAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010917.2-4190s21c1
Sequence:CCGGGCCAATTATCTTGTCTGTATACTCGAGTATACAGACAAGATAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010917.1-2117s1c1
Sequence:CCGGCGGGCAGACTTGCTATGATATCTCGAGATATCATAGCAAGTCTGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010917.1-2274s1c1
Sequence:CCGGCGTCCCATCAACTACTGTGAACTCGAGTTCACAGTAGTTGATGGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010917.1-2829s1c1
Sequence:CCGGCCAGGGACACACTTACTCTTTCTCGAGAAAGAGTAAGTGTGTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010917.1-3536s1c1
Sequence:CCGGCCTTGCTATATCCAAAGAGATCTCGAGATCTCTTTGGATATAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010917.1-4099s1c1
Sequence:CCGGGCCAATTATCTTGTCTGTATACTCGAGTATACAGACAAGATAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010917
VALIDATED
NID1 MISSION shRNA shRNA Plasmid DNA
nidogen 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010917.2-2206s21c1
Sequence:CCGGCGGGCAGACTTGCTATGATATCTCGAGATATCATAGCAAGTCTGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010917.2-2918s21c1
Sequence:CCGGCCAGGGACACACTTACTCTTTCTCGAGAAAGAGTAAGTGTGTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010917.2-3625s21c1
Sequence:CCGGCCTTGCTATATCCAAAGAGATCTCGAGATCTCTTTGGATATAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010917.2-4190s21c1
Sequence:CCGGGCCAATTATCTTGTCTGTATACTCGAGTATACAGACAAGATAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010917.1-2117s1c1
Sequence:CCGGCGGGCAGACTTGCTATGATATCTCGAGATATCATAGCAAGTCTGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010917.1-2274s1c1
Sequence:CCGGCGTCCCATCAACTACTGTGAACTCGAGTTCACAGTAGTTGATGGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010917.1-2829s1c1
Sequence:CCGGCCAGGGACACACTTACTCTTTCTCGAGAAAGAGTAAGTGTGTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010917.1-3536s1c1
Sequence:CCGGCCTTGCTATATCCAAAGAGATCTCGAGATCTCTTTGGATATAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010917.1-4099s1c1
Sequence:CCGGGCCAATTATCTTGTCTGTATACTCGAGTATACAGACAAGATAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010917
VALIDATED
NID1 MISSION shRNA Lentiviral Transduction Particles
nidogen 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010917.2-2206s21c1
Sequence:CCGGCGGGCAGACTTGCTATGATATCTCGAGATATCATAGCAAGTCTGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010917.2-2918s21c1
Sequence:CCGGCCAGGGACACACTTACTCTTTCTCGAGAAAGAGTAAGTGTGTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010917.2-3625s21c1
Sequence:CCGGCCTTGCTATATCCAAAGAGATCTCGAGATCTCTTTGGATATAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010917.2-4190s21c1
Sequence:CCGGGCCAATTATCTTGTCTGTATACTCGAGTATACAGACAAGATAATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010917.1-2117s1c1
Sequence:CCGGCGGGCAGACTTGCTATGATATCTCGAGATATCATAGCAAGTCTGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010917.1-2274s1c1
Sequence:CCGGCGTCCCATCAACTACTGTGAACTCGAGTTCACAGTAGTTGATGGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010917.1-2829s1c1
Sequence:CCGGCCAGGGACACACTTACTCTTTCTCGAGAAAGAGTAAGTGTGTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010917.1-3536s1c1
Sequence:CCGGCCTTGCTATATCCAAAGAGATCTCGAGATCTCTTTGGATATAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010917.1-4099s1c1
Sequence:CCGGGCCAATTATCTTGTCTGTATACTCGAGTATACAGACAAGATAATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002508
VALIDATED
NID1 MISSION shRNA Bacterial Glycerol Stock
nidogen 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002508.2-3026s21c1
Sequence:CCGGTCCCGGCTAAAGTCATCATTGCTCGAGCAATGATGACTTTAGCCGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002508.2-1473s21c1
Sequence:CCGGCCTCCACTCTTACGTAGTAATCTCGAGATTACTACGTAAGAGTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002508.2-1529s21c1
Sequence:CCGGTTCCCGAGACCGTTGGATATTCTCGAGAATATCCAACGGTCTCGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002508.2-2920s21c1
Sequence:CCGGTTGCCTCCTGGGACCCATTTACTCGAGTAAATGGGTCCCAGGAGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002508.2-4506s21c1
Sequence:CCGGCCTCCCAGATAGAATGTCAATCTCGAGATTGACATTCTATCTGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002508.1-3287s1c1
Sequence:CCGGCCAGAGGCATTGTAACGGATTCTCGAGAATCCGTTACAATGCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002508.1-307s1c1
Sequence:CCGGGCAGTCTACGTCACCACAAATCTCGAGATTTGTGGTGACGTAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002508.1-1183s1c1
Sequence:CCGGCCTCAGGTCATAGATGTGGATCTCGAGATCCACATCTATGACCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002508.1-4497s1c1
Sequence:CCGGCCTCCCAGATAGAATGTCAATCTCGAGATTGACATTCTATCTGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002508.1-3157s1c1
Sequence:CCGGCCAGAAGGTATCGCTGTTGATCTCGAGATCAACAGCGATACCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002508
VALIDATED
NID1 MISSION shRNA shRNA Plasmid DNA
nidogen 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002508.2-3026s21c1
Sequence:CCGGTCCCGGCTAAAGTCATCATTGCTCGAGCAATGATGACTTTAGCCGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002508.2-1473s21c1
Sequence:CCGGCCTCCACTCTTACGTAGTAATCTCGAGATTACTACGTAAGAGTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002508.2-1529s21c1
Sequence:CCGGTTCCCGAGACCGTTGGATATTCTCGAGAATATCCAACGGTCTCGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002508.2-2920s21c1
Sequence:CCGGTTGCCTCCTGGGACCCATTTACTCGAGTAAATGGGTCCCAGGAGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002508.2-4506s21c1
Sequence:CCGGCCTCCCAGATAGAATGTCAATCTCGAGATTGACATTCTATCTGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002508.1-3287s1c1
Sequence:CCGGCCAGAGGCATTGTAACGGATTCTCGAGAATCCGTTACAATGCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002508.1-307s1c1
Sequence:CCGGGCAGTCTACGTCACCACAAATCTCGAGATTTGTGGTGACGTAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002508.1-1183s1c1
Sequence:CCGGCCTCAGGTCATAGATGTGGATCTCGAGATCCACATCTATGACCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002508.1-4497s1c1
Sequence:CCGGCCTCCCAGATAGAATGTCAATCTCGAGATTGACATTCTATCTGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002508.1-3157s1c1
Sequence:CCGGCCAGAAGGTATCGCTGTTGATCTCGAGATCAACAGCGATACCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002508
VALIDATED
NID1 MISSION shRNA Lentiviral Transduction Particles
nidogen 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002508.2-3026s21c1
Sequence:CCGGTCCCGGCTAAAGTCATCATTGCTCGAGCAATGATGACTTTAGCCGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002508.2-1473s21c1
Sequence:CCGGCCTCCACTCTTACGTAGTAATCTCGAGATTACTACGTAAGAGTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002508.2-1529s21c1
Sequence:CCGGTTCCCGAGACCGTTGGATATTCTCGAGAATATCCAACGGTCTCGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002508.2-2920s21c1
Sequence:CCGGTTGCCTCCTGGGACCCATTTACTCGAGTAAATGGGTCCCAGGAGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002508.2-4506s21c1
Sequence:CCGGCCTCCCAGATAGAATGTCAATCTCGAGATTGACATTCTATCTGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002508.1-3287s1c1
Sequence:CCGGCCAGAGGCATTGTAACGGATTCTCGAGAATCCGTTACAATGCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002508.1-307s1c1
Sequence:CCGGGCAGTCTACGTCACCACAAATCTCGAGATTTGTGGTGACGTAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002508.1-1183s1c1
Sequence:CCGGCCTCAGGTCATAGATGTGGATCTCGAGATCCACATCTATGACCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002508.1-4497s1c1
Sequence:CCGGCCTCCCAGATAGAATGTCAATCTCGAGATTGACATTCTATCTGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002508.1-3157s1c1
Sequence:CCGGCCAGAAGGTATCGCTGTTGATCTCGAGATCAACAGCGATACCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)