EMAIL THIS PAGE TO A FRIEND

NIF3L1

NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)

62 Gene Product Result for
Synonyms: ALS2CR1 CALS-7
UniProtKB ID: Q9GZT8, Q53TX4, Q6X735, Q9H2D2, Q9HC18
Gene ID:
Mouse(65102) Ngg1 interacting factor 3-like 1 (S. pombe)
Rat(301431) NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)
Goat(100861375) NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)
sheep(101105887) NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)
domestic guinea pig(100719103) NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)
naked mole-rat(101718919) NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)
Domestic Rabbit(100340828) NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)
Zebrafish(574421) NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)
chicken(424076) NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)
domestic cat(101092874) NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)
cow(509473) NIF3 NGG1 interacting factor 3-like 1 (S. pombe)
Horse(100068044) NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)
dog(607446) NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021824 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022988 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022988 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022988 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021824 Rosetta Predictions human pricing
NM_001024763 Rosetta Predictions rat pricing
NM_022988 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170353 predicted 982
2 SASI_Hs01_00170354 predicted 692
3 SASI_Hs01_00170355 predicted 818
4 SASI_Hs01_00170356 predicted 1263
5 SASI_Hs01_00170357 predicted 886
6 SASI_Hs01_00170358 predicted 954
7 SASI_Hs01_00170359 predicted 363
8 SASI_Hs01_00170360 predicted 680
9 SASI_Hs01_00170361 predicted 760
10 SASI_Hs01_00170362 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055649 predicted 1108
2 SASI_Rn01_00055650 predicted 1162
3 SASI_Rn01_00055651 predicted 401
4 SASI_Rn01_00055652 predicted 1019
5 SASI_Rn01_00055653 predicted 970
6 SASI_Rn01_00055654 predicted 981
7 SASI_Rn01_00055655 predicted 387
8 SASI_Rn01_00055656 predicted 738
9 SASI_Rn01_00055657 predicted 382
10 SASI_Rn01_00055658 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022988 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200261 predicted 1194
2 SASI_Mm01_00200262 predicted 431
3 SASI_Mm01_00200263 predicted 956
4 SASI_Mm01_00200264 predicted 1090
5 SASI_Mm02_00326711 predicted 704
6 SASI_Mm01_00200265 predicted 1255
7 SASI_Mm01_00200266 predicted 1109
8 SASI_Mm01_00200267 predicted 671
9 SASI_Mm01_00200268 predicted 1071
10 SASI_Mm01_00200269 predicted 523
11 SASI_Mm01_00200260 predicted 804
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021824
VALIDATED
NIF3L1 MISSION shRNA Bacterial Glycerol Stock
NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_021824.1-1224s1c1
Sequence:CCGGGCTGGATTCTCACTTGGAGAACTCGAGTTCTCCAAGTGAGAATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_021824.1-298s1c1
Sequence:CCGGGCTGAGAGTTGGGACAATGTTCTCGAGAACATTGTCCCAACTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_021824.1-681s1c1
Sequence:CCGGCGTTAACTACACCCAAGACCTCTCGAGAGGTCTTGGGTGTAGTTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021824.1-1101s1c1
Sequence:CCGGCCTTTACCTCACAGGTGAGATCTCGAGATCTCACCTGTGAGGTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021824.1-721s1c1
Sequence:CCGGGTGAAAGGAATTGACGGTGTTCTCGAGAACACCGTCAATTCCTTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021824.3-379s21c1
Sequence:CCGGGCTGAGAGTTGGGACAATGTTCTCGAGAACATTGTCCCAACTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021824.3-1179s21c1
Sequence:CCGGCCTTTACCTCACAGGTGAGATCTCGAGATCTCACCTGTGAGGTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021824.3-759s21c1
Sequence:CCGGCGTTAACTACACCCAAGACCTCTCGAGAGGTCTTGGGTGTAGTTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021824.3-1302s21c1
Sequence:CCGGGCTGGATTCTCACTTGGAGAACTCGAGTTCTCCAAGTGAGAATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021824
VALIDATED
NIF3L1 MISSION shRNA shRNA Plasmid DNA
NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_021824.1-1224s1c1
Sequence:CCGGGCTGGATTCTCACTTGGAGAACTCGAGTTCTCCAAGTGAGAATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_021824.1-298s1c1
Sequence:CCGGGCTGAGAGTTGGGACAATGTTCTCGAGAACATTGTCCCAACTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_021824.1-681s1c1
Sequence:CCGGCGTTAACTACACCCAAGACCTCTCGAGAGGTCTTGGGTGTAGTTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021824.1-1101s1c1
Sequence:CCGGCCTTTACCTCACAGGTGAGATCTCGAGATCTCACCTGTGAGGTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021824.1-721s1c1
Sequence:CCGGGTGAAAGGAATTGACGGTGTTCTCGAGAACACCGTCAATTCCTTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021824.3-379s21c1
Sequence:CCGGGCTGAGAGTTGGGACAATGTTCTCGAGAACATTGTCCCAACTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021824.3-1179s21c1
Sequence:CCGGCCTTTACCTCACAGGTGAGATCTCGAGATCTCACCTGTGAGGTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021824.3-759s21c1
Sequence:CCGGCGTTAACTACACCCAAGACCTCTCGAGAGGTCTTGGGTGTAGTTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021824.3-1302s21c1
Sequence:CCGGGCTGGATTCTCACTTGGAGAACTCGAGTTCTCCAAGTGAGAATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021824
VALIDATED
NIF3L1 MISSION shRNA Lentiviral Transduction Particles
NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_021824.1-1224s1c1
Sequence:CCGGGCTGGATTCTCACTTGGAGAACTCGAGTTCTCCAAGTGAGAATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_021824.1-298s1c1
Sequence:CCGGGCTGAGAGTTGGGACAATGTTCTCGAGAACATTGTCCCAACTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_021824.1-681s1c1
Sequence:CCGGCGTTAACTACACCCAAGACCTCTCGAGAGGTCTTGGGTGTAGTTAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021824.1-1101s1c1
Sequence:CCGGCCTTTACCTCACAGGTGAGATCTCGAGATCTCACCTGTGAGGTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021824.1-721s1c1
Sequence:CCGGGTGAAAGGAATTGACGGTGTTCTCGAGAACACCGTCAATTCCTTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021824.3-379s21c1
Sequence:CCGGGCTGAGAGTTGGGACAATGTTCTCGAGAACATTGTCCCAACTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021824.3-1179s21c1
Sequence:CCGGCCTTTACCTCACAGGTGAGATCTCGAGATCTCACCTGTGAGGTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021824.3-759s21c1
Sequence:CCGGCGTTAACTACACCCAAGACCTCTCGAGAGGTCTTGGGTGTAGTTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021824.3-1302s21c1
Sequence:CCGGGCTGGATTCTCACTTGGAGAACTCGAGTTCTCCAAGTGAGAATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022988
VALIDATED
NIF3L1 MISSION shRNA Bacterial Glycerol Stock
NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022988.2-841s1c1
Sequence:CCGGCACCTAAAGCTGTCGCATCTTCTCGAGAAGATGCGACAGCTTTAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022988.2-654s1c1
Sequence:CCGGCAGCCTGAATTGTACTCAGAACTCGAGTTCTGAGTACAATTCAGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022988.2-1481s1c1
Sequence:CCGGGCCAAGTTTATTCAGAGCCATCTCGAGATGGCTCTGAATAAACTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022988.2-1006s1c1
Sequence:CCGGGCTGCTTCCAAAGGGATCAATCTCGAGATTGATCCCTTTGGAAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022988.2-1007s21c1
Sequence:CCGGCTGCTTCCAAAGGGATCAATGCTCGAGCATTGATCCCTTTGGAAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022988.2-1492s21c1
Sequence:CCGGTCAGAGCCATCGGACAATTTACTCGAGTAAATTGTCCGATGGCTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022988.2-814s21c1
Sequence:GTACCGGGCAATAATGATAGAGCGAATCCTCGAGGATTCGCTCTATCATTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022988.2-1141s21c1
Sequence:CCGGGACCCTCTCCGTGTGGTTTAACTCGAGTTAAACCACACGGAGAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022988.2-296s21c1
Sequence:CCGGTCTCCTACCATCCACCTATTTCTCGAGAAATAGGTGGATGGTAGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022988
VALIDATED
NIF3L1 MISSION shRNA shRNA Plasmid DNA
NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022988.2-841s1c1
Sequence:CCGGCACCTAAAGCTGTCGCATCTTCTCGAGAAGATGCGACAGCTTTAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022988.2-654s1c1
Sequence:CCGGCAGCCTGAATTGTACTCAGAACTCGAGTTCTGAGTACAATTCAGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022988.2-1481s1c1
Sequence:CCGGGCCAAGTTTATTCAGAGCCATCTCGAGATGGCTCTGAATAAACTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022988.2-1006s1c1
Sequence:CCGGGCTGCTTCCAAAGGGATCAATCTCGAGATTGATCCCTTTGGAAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022988.2-1007s21c1
Sequence:CCGGCTGCTTCCAAAGGGATCAATGCTCGAGCATTGATCCCTTTGGAAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022988.2-1492s21c1
Sequence:CCGGTCAGAGCCATCGGACAATTTACTCGAGTAAATTGTCCGATGGCTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022988.2-814s21c1
Sequence:GTACCGGGCAATAATGATAGAGCGAATCCTCGAGGATTCGCTCTATCATTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022988.2-1141s21c1
Sequence:CCGGGACCCTCTCCGTGTGGTTTAACTCGAGTTAAACCACACGGAGAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022988.2-296s21c1
Sequence:CCGGTCTCCTACCATCCACCTATTTCTCGAGAAATAGGTGGATGGTAGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022988
VALIDATED
NIF3L1 MISSION shRNA Lentiviral Transduction Particles
NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022988.2-841s1c1
Sequence:CCGGCACCTAAAGCTGTCGCATCTTCTCGAGAAGATGCGACAGCTTTAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022988.2-654s1c1
Sequence:CCGGCAGCCTGAATTGTACTCAGAACTCGAGTTCTGAGTACAATTCAGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022988.2-1481s1c1
Sequence:CCGGGCCAAGTTTATTCAGAGCCATCTCGAGATGGCTCTGAATAAACTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022988.2-1006s1c1
Sequence:CCGGGCTGCTTCCAAAGGGATCAATCTCGAGATTGATCCCTTTGGAAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022988.2-1007s21c1
Sequence:CCGGCTGCTTCCAAAGGGATCAATGCTCGAGCATTGATCCCTTTGGAAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022988.2-1492s21c1
Sequence:CCGGTCAGAGCCATCGGACAATTTACTCGAGTAAATTGTCCGATGGCTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022988.2-814s21c1
Sequence:GTACCGGGCAATAATGATAGAGCGAATCCTCGAGGATTCGCTCTATCATTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022988.2-1141s21c1
Sequence:CCGGGACCCTCTCCGTGTGGTTTAACTCGAGTTAAACCACACGGAGAGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022988.2-296s21c1
Sequence:CCGGTCTCCTACCATCCACCTATTTCTCGAGAAATAGGTGGATGGTAGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)