EMAIL THIS PAGE TO A FRIEND

NIM1

68 Gene Product Result for
UniProtKB ID: Q8IY84, B3KVM1
Gene ID:
Mouse(245269) serine/threonine-protein kinase NIM1
Rat(310376) serine/threonine-protein kinase NIM1
chicken(768482) serine/threonine-protein kinase NIM1
dog(489218) serine/threonine-protein kinase NIM1
cow(530210) serine/threonine-protein kinase NIM1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175538 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175538 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175538 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153361 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017341 MISSION® esiRNA esiRNA targeting human MGC42105 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153361 Rosetta Predictions human pricing
XM_001076547 Rosetta Predictions rat pricing
XM_227081 Rosetta Predictions rat pricing
NM_175538 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025049 predicted 1820
2 SASI_Hs01_00025050 predicted 1971
3 SASI_Hs01_00025051 predicted 1234
4 SASI_Hs01_00025052 predicted 1697
5 SASI_Hs01_00025053 predicted 1143
6 SASI_Hs02_00367228 predicted 1488
7 SASI_Hs01_00025056 predicted 1408
8 SASI_Hs01_00025057 predicted 1266
9 SASI_Hs02_00367229 predicted 1625
10 SASI_Hs01_00025058 predicted 1500
11 SASI_Hs01_00025054 predicted 1447
12 SASI_Hs01_00025055 predicted 1550
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353664 predicted 936
2 SASI_Rn02_00353665 predicted 380
3 SASI_Rn02_00353666 predicted 269
4 SASI_Rn02_00353667 predicted 494
5 SASI_Rn02_00353668 predicted 808
6 SASI_Rn02_00353669 predicted 653
7 SASI_Rn02_00353670 predicted 382
8 SASI_Rn02_00353671 predicted 346
9 SASI_Rn02_00353672 predicted 1002
10 SASI_Rn02_00353673 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384051 predicted 267
2 SASI_Rn02_00384052 predicted 263
3 SASI_Rn02_00384053 predicted 265
4 SASI_Rn02_00384054 predicted 271
5 SASI_Rn02_00384055 predicted 257
6 SASI_Rn02_00384056 predicted 298
7 SASI_Rn02_00384057 predicted 204
8 SASI_Rn02_00384058 predicted 208
9 SASI_Rn02_00384059 predicted 233
10 SASI_Rn02_00384060 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176590 predicted 2065
2 SASI_Mm01_00176591 predicted 2034
3 SASI_Mm01_00176592 predicted 1225
4 SASI_Mm01_00176593 predicted 1186
5 SASI_Mm01_00176594 predicted 1197
6 SASI_Mm01_00176595 predicted 2033
7 SASI_Mm01_00176596 predicted 1480
8 SASI_Mm01_00176597 predicted 2103
9 SASI_Mm01_00176598 predicted 1523
10 SASI_Mm01_00176599 predicted 2096
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175538
NIM1 MISSION shRNA Bacterial Glycerol Stock
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175538.3-2466s21c1
Sequence:CCGGGACCATTGCTAGCAACTATTTCTCGAGAAATAGTTGCTAGCAATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175538.3-1942s21c1
Sequence:CCGGGACGAACATATCCGGAATAACCTCGAGGTTATTCCGGATATGTTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175538.3-1230s21c1
Sequence:CCGGTCCCAACATCGTCCGTCTTTACTCGAGTAAAGACGGACGATGTTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175538.2-1142s1c1
Sequence:CCGGGCCATTAAGATTCTGGACAAACTCGAGTTTGTCCAGAATCTTAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175538.2-1582s1c1
Sequence:CCGGCGTTGGTGTTTATGTGGATATCTCGAGATATCCACATAAACACCAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175538.2-1232s1c1
Sequence:CCGGCCCAACATCGTCCGTCTTTATCTCGAGATAAAGACGGACGATGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175538.2-1955s1c1
Sequence:CCGGCGGAATAACCAAGGGAGAGATCTCGAGATCTCTCCCTTGGTTATTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175538.2-2100s1c1
Sequence:CCGGCCCGTATCTACAGAGGCATAACTCGAGTTATGCCTCTGTAGATACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175538
NIM1 MISSION shRNA shRNA Plasmid DNA
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175538.3-2466s21c1
Sequence:CCGGGACCATTGCTAGCAACTATTTCTCGAGAAATAGTTGCTAGCAATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175538.3-1942s21c1
Sequence:CCGGGACGAACATATCCGGAATAACCTCGAGGTTATTCCGGATATGTTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175538.3-1230s21c1
Sequence:CCGGTCCCAACATCGTCCGTCTTTACTCGAGTAAAGACGGACGATGTTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175538.2-1142s1c1
Sequence:CCGGGCCATTAAGATTCTGGACAAACTCGAGTTTGTCCAGAATCTTAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175538.2-1582s1c1
Sequence:CCGGCGTTGGTGTTTATGTGGATATCTCGAGATATCCACATAAACACCAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175538.2-1232s1c1
Sequence:CCGGCCCAACATCGTCCGTCTTTATCTCGAGATAAAGACGGACGATGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175538.2-1955s1c1
Sequence:CCGGCGGAATAACCAAGGGAGAGATCTCGAGATCTCTCCCTTGGTTATTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175538.2-2100s1c1
Sequence:CCGGCCCGTATCTACAGAGGCATAACTCGAGTTATGCCTCTGTAGATACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175538
NIM1 MISSION shRNA Lentiviral Transduction Particles
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175538.3-2466s21c1
Sequence:CCGGGACCATTGCTAGCAACTATTTCTCGAGAAATAGTTGCTAGCAATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175538.3-1942s21c1
Sequence:CCGGGACGAACATATCCGGAATAACCTCGAGGTTATTCCGGATATGTTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175538.3-1230s21c1
Sequence:CCGGTCCCAACATCGTCCGTCTTTACTCGAGTAAAGACGGACGATGTTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175538.2-1142s1c1
Sequence:CCGGGCCATTAAGATTCTGGACAAACTCGAGTTTGTCCAGAATCTTAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175538.2-1582s1c1
Sequence:CCGGCGTTGGTGTTTATGTGGATATCTCGAGATATCCACATAAACACCAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175538.2-1232s1c1
Sequence:CCGGCCCAACATCGTCCGTCTTTATCTCGAGATAAAGACGGACGATGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175538.2-1955s1c1
Sequence:CCGGCGGAATAACCAAGGGAGAGATCTCGAGATCTCTCCCTTGGTTATTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175538.2-2100s1c1
Sequence:CCGGCCCGTATCTACAGAGGCATAACTCGAGTTATGCCTCTGTAGATACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153361
NIM1 MISSION shRNA Bacterial Glycerol Stock
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1182s1c1
Sequence:CCGGGCCATTAAGATCCTGGACAAGCTCGAGCTTGTCCAGGATCTTAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-952s1c1
Sequence:CCGGGTGTAGAAAGTGGCTGTCAGACTCGAGTCTGACAGCCACTTTCTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1272s1c1
Sequence:CCGGCCCAACATCATCCGCCTTTACCTCGAGGTAAAGGCGGATGATGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1823s1c1
Sequence:CCGGCGGAATCGACTGCATCATGAACTCGAGTTCATGATGCAGTCGATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153361.2-1902s1c1
Sequence:CCGGCCCAAACATTTGTCGGAAACCCTCGAGGGTTTCCGACAAATGTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153361.2-1983s1c1
Sequence:CCGGGAAGAGCATATTCGAAATAACCTCGAGGTTATTTCGAATATGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153361.2-1415s1c1
Sequence:CCGGCCAGATTGTGTCTGCCGTGAACTCGAGTTCACGGCAGACACAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1613s1c1
Sequence:CCGGCGAGCACTACATCGGCATTTACTCGAGTAAATGCCGATGTAGTGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1226s1c1
Sequence:CCGGGAGGCTACTATCCCGAGAAATCTCGAGATTTCTCGGGATAGTAGCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-2156s1c1
Sequence:CCGGGATAAGACACACATCCAAATTCTCGAGAATTTGGATGTGTGTCTTATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1089s1c1
Sequence:CCGGCGGATAGGCTTCTACCGAATTCTCGAGAATTCGGTAGAAGCCTATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1871s1c1
Sequence:CCGGCCCTACACCTTTGGAACCTTTCTCGAGAAAGGTTCCAAAGGTGTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153361
NIM1 MISSION shRNA shRNA Plasmid DNA
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1182s1c1
Sequence:CCGGGCCATTAAGATCCTGGACAAGCTCGAGCTTGTCCAGGATCTTAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-952s1c1
Sequence:CCGGGTGTAGAAAGTGGCTGTCAGACTCGAGTCTGACAGCCACTTTCTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1272s1c1
Sequence:CCGGCCCAACATCATCCGCCTTTACCTCGAGGTAAAGGCGGATGATGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1823s1c1
Sequence:CCGGCGGAATCGACTGCATCATGAACTCGAGTTCATGATGCAGTCGATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153361.2-1902s1c1
Sequence:CCGGCCCAAACATTTGTCGGAAACCCTCGAGGGTTTCCGACAAATGTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153361.2-1983s1c1
Sequence:CCGGGAAGAGCATATTCGAAATAACCTCGAGGTTATTTCGAATATGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153361.2-1415s1c1
Sequence:CCGGCCAGATTGTGTCTGCCGTGAACTCGAGTTCACGGCAGACACAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1613s1c1
Sequence:CCGGCGAGCACTACATCGGCATTTACTCGAGTAAATGCCGATGTAGTGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1226s1c1
Sequence:CCGGGAGGCTACTATCCCGAGAAATCTCGAGATTTCTCGGGATAGTAGCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-2156s1c1
Sequence:CCGGGATAAGACACACATCCAAATTCTCGAGAATTTGGATGTGTGTCTTATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1089s1c1
Sequence:CCGGCGGATAGGCTTCTACCGAATTCTCGAGAATTCGGTAGAAGCCTATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1871s1c1
Sequence:CCGGCCCTACACCTTTGGAACCTTTCTCGAGAAAGGTTCCAAAGGTGTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153361
NIM1 MISSION shRNA Lentiviral Transduction Particles
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1182s1c1
Sequence:CCGGGCCATTAAGATCCTGGACAAGCTCGAGCTTGTCCAGGATCTTAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-952s1c1
Sequence:CCGGGTGTAGAAAGTGGCTGTCAGACTCGAGTCTGACAGCCACTTTCTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1272s1c1
Sequence:CCGGCCCAACATCATCCGCCTTTACCTCGAGGTAAAGGCGGATGATGTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1823s1c1
Sequence:CCGGCGGAATCGACTGCATCATGAACTCGAGTTCATGATGCAGTCGATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153361.2-1902s1c1
Sequence:CCGGCCCAAACATTTGTCGGAAACCCTCGAGGGTTTCCGACAAATGTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153361.2-1983s1c1
Sequence:CCGGGAAGAGCATATTCGAAATAACCTCGAGGTTATTTCGAATATGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153361.2-1415s1c1
Sequence:CCGGCCAGATTGTGTCTGCCGTGAACTCGAGTTCACGGCAGACACAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1613s1c1
Sequence:CCGGCGAGCACTACATCGGCATTTACTCGAGTAAATGCCGATGTAGTGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1226s1c1
Sequence:CCGGGAGGCTACTATCCCGAGAAATCTCGAGATTTCTCGGGATAGTAGCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-2156s1c1
Sequence:CCGGGATAAGACACACATCCAAATTCTCGAGAATTTGGATGTGTGTCTTATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1089s1c1
Sequence:CCGGCGGATAGGCTTCTACCGAATTCTCGAGAATTCGGTAGAAGCCTATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153361.2-1871s1c1
Sequence:CCGGCCCTACACCTTTGGAACCTTTCTCGAGAAAGGTTCCAAAGGTGTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)