EMAIL THIS PAGE TO A FRIEND

NINJ1

ninjurin 1

58 Gene Product Result for
Synonyms: NIN1 NINJURIN
UniProtKB ID: Q92982, Q6GU89, Q8WUV5, Q9BT07
Gene ID:
Human(4814) Summary: The ninjurin protein is upregulated after nerve injury both in dorsal root ganglion neurons and in Schwann cells (Araki and Milbrandt, 1996 [PubMed 8780658]
Mouse(18081) ninjurin 1
Rat(25338) ninjurin 1
chicken(415986) ninjurin 1
cow(511468) ninjurin 1
dog(610587) ninjurin-1-like
Goat(100861274) ninjurin 1
sheep(101106905) ninjurin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004148 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004148 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004148 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004148 Rosetta Predictions human pricing
NM_012867 Rosetta Predictions rat pricing
NM_013610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175634 predicted 355
2 SASI_Hs02_00336998 predicted 390
3 SASI_Hs01_00175635 predicted 582
4 SASI_Hs01_00175636 predicted 224
5 SASI_Hs01_00175641 predicted 362
6 SASI_Hs01_00175637 predicted 439
7 SASI_Hs01_00175638 predicted 321
8 SASI_Hs01_00175639 predicted 360
9 SASI_Hs01_00175640 predicted 370
10 SASI_Hs01_00175643 predicted 448
11 SASI_Hs01_00175642 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260351 predicted 447
2 SASI_Rn01_00119875 predicted 830
3 SASI_Rn01_00119876 predicted 733
4 SASI_Rn02_00260352 predicted 721
5 SASI_Rn01_00119877 predicted 208
6 SASI_Rn01_00119878 predicted 865
7 SASI_Rn02_00260353 predicted 539
8 SASI_Rn01_00119879 predicted 647
9 SASI_Rn02_00260354 predicted 384
10 SASI_Rn01_00119882 predicted 829
11 SASI_Rn01_00119880 predicted 723
12 SASI_Rn01_00119881 predicted 300
13 SASI_Rn01_00119883 predicted 590
14 SASI_Rn01_00119884 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135463 predicted 227
2 SASI_Mm02_00322362 predicted 466
3 SASI_Mm01_00135465 predicted 745
4 SASI_Mm01_00135466 predicted 247
5 SASI_Mm01_00135467 predicted 344
6 SASI_Mm01_00135468 predicted 739
7 SASI_Mm01_00135469 predicted 614
8 SASI_Mm01_00135470 predicted 541
9 SASI_Mm01_00135471 predicted 737
10 SASI_Mm02_00322363 predicted 735
11 SASI_Mm01_00135464 predicted 784
12 SASI_Mm01_00135472 predicted 845
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013610
VALIDATED
NINJ1 MISSION shRNA Bacterial Glycerol Stock
ninjurin 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013610.2-406s21c1
Sequence:CCGGCGTGGTCAACATCTTCATTACCTCGAGGTAATGAAGATGTTGACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013610.2-127s21c1
Sequence:CCGGTGTAAACCATTATGCCAACAACTCGAGTTGTTGGCATAATGGTTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013610.2-473s21c1
Sequence:CCGGTAGAACGCCCAGAGACTTTAACTCGAGTTAAAGTCTCTGGGCGTTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013610.2-674s21c1
Sequence:CCGGGCCATGAAGATCAGAACTGGACTCGAGTCCAGTTCTGATCTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013610.2-316s21c1
Sequence:CCGGCCTGGTCAAGTATGACCTCAACTCGAGTTGAGGTCATACTTGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013610.1-674s1c1
Sequence:CCGGGCCATGAAGATCAGAACTGGACTCGAGTCCAGTTCTGATCTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013610.1-116s1c1
Sequence:CCGGCGGCCCATCAATGTAAACCATCTCGAGATGGTTTACATTGATGGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013610.1-127s1c1
Sequence:CCGGTGTAAACCATTATGCCAACAACTCGAGTTGTTGGCATAATGGTTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013610.1-316s1c1
Sequence:CCGGCCTGGTCAAGTATGACCTCAACTCGAGTTGAGGTCATACTTGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013610
VALIDATED
NINJ1 MISSION shRNA shRNA Plasmid DNA
ninjurin 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013610.2-406s21c1
Sequence:CCGGCGTGGTCAACATCTTCATTACCTCGAGGTAATGAAGATGTTGACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013610.2-127s21c1
Sequence:CCGGTGTAAACCATTATGCCAACAACTCGAGTTGTTGGCATAATGGTTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013610.2-473s21c1
Sequence:CCGGTAGAACGCCCAGAGACTTTAACTCGAGTTAAAGTCTCTGGGCGTTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013610.2-674s21c1
Sequence:CCGGGCCATGAAGATCAGAACTGGACTCGAGTCCAGTTCTGATCTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013610.2-316s21c1
Sequence:CCGGCCTGGTCAAGTATGACCTCAACTCGAGTTGAGGTCATACTTGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013610.1-674s1c1
Sequence:CCGGGCCATGAAGATCAGAACTGGACTCGAGTCCAGTTCTGATCTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013610.1-116s1c1
Sequence:CCGGCGGCCCATCAATGTAAACCATCTCGAGATGGTTTACATTGATGGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013610.1-127s1c1
Sequence:CCGGTGTAAACCATTATGCCAACAACTCGAGTTGTTGGCATAATGGTTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013610.1-316s1c1
Sequence:CCGGCCTGGTCAAGTATGACCTCAACTCGAGTTGAGGTCATACTTGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013610
VALIDATED
NINJ1 MISSION shRNA Lentiviral Transduction Particles
ninjurin 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013610.2-406s21c1
Sequence:CCGGCGTGGTCAACATCTTCATTACCTCGAGGTAATGAAGATGTTGACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013610.2-127s21c1
Sequence:CCGGTGTAAACCATTATGCCAACAACTCGAGTTGTTGGCATAATGGTTTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013610.2-473s21c1
Sequence:CCGGTAGAACGCCCAGAGACTTTAACTCGAGTTAAAGTCTCTGGGCGTTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013610.2-674s21c1
Sequence:CCGGGCCATGAAGATCAGAACTGGACTCGAGTCCAGTTCTGATCTTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013610.2-316s21c1
Sequence:CCGGCCTGGTCAAGTATGACCTCAACTCGAGTTGAGGTCATACTTGACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013610.1-674s1c1
Sequence:CCGGGCCATGAAGATCAGAACTGGACTCGAGTCCAGTTCTGATCTTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013610.1-116s1c1
Sequence:CCGGCGGCCCATCAATGTAAACCATCTCGAGATGGTTTACATTGATGGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013610.1-127s1c1
Sequence:CCGGTGTAAACCATTATGCCAACAACTCGAGTTGTTGGCATAATGGTTTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013610.1-316s1c1
Sequence:CCGGCCTGGTCAAGTATGACCTCAACTCGAGTTGAGGTCATACTTGACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004148
VALIDATED
NINJ1 MISSION shRNA Bacterial Glycerol Stock
ninjurin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004148.3-444s21c1
Sequence:CCGGCTGGTGTTCATCATCGTGGTACTCGAGTACCACGATGATGAACACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004148.3-458s21c1
Sequence:CCGGCGTGGTAGTCAACATCTTCATCTCGAGATGAAGATGTTGACTACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004148.3-371s21c1
Sequence:CCGGCCTTGTCAAGTACGACCTTAACTCGAGTTAAGGTCGTACTTGACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004148.3-224s21c1
Sequence:CCGGGCTGGACATCGCGCTGCTGATCTCGAGATCAGCAGCGCGATGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004148.2-371s1c1
Sequence:CCGGCCTTGTCAAGTACGACCTTAACTCGAGTTAAGGTCGTACTTGACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004148.2-362s1c1
Sequence:CCGGGCTCATCTTCCTTGTCAAGTACTCGAGTACTTGACAAGGAAGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004148.2-224s1c1
Sequence:CCGGGCTGGACATCGCGCTGCTGATCTCGAGATCAGCAGCGCGATGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004148.2-444s1c1
Sequence:CCGGCTGGTGTTCATCATCGTGGTACTCGAGTACCACGATGATGAACACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004148.2-458s1c1
Sequence:CCGGCGTGGTAGTCAACATCTTCATCTCGAGATGAAGATGTTGACTACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004148
VALIDATED
NINJ1 MISSION shRNA shRNA Plasmid DNA
ninjurin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004148.3-444s21c1
Sequence:CCGGCTGGTGTTCATCATCGTGGTACTCGAGTACCACGATGATGAACACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004148.3-458s21c1
Sequence:CCGGCGTGGTAGTCAACATCTTCATCTCGAGATGAAGATGTTGACTACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004148.3-371s21c1
Sequence:CCGGCCTTGTCAAGTACGACCTTAACTCGAGTTAAGGTCGTACTTGACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004148.3-224s21c1
Sequence:CCGGGCTGGACATCGCGCTGCTGATCTCGAGATCAGCAGCGCGATGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004148.2-371s1c1
Sequence:CCGGCCTTGTCAAGTACGACCTTAACTCGAGTTAAGGTCGTACTTGACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004148.2-362s1c1
Sequence:CCGGGCTCATCTTCCTTGTCAAGTACTCGAGTACTTGACAAGGAAGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004148.2-224s1c1
Sequence:CCGGGCTGGACATCGCGCTGCTGATCTCGAGATCAGCAGCGCGATGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004148.2-444s1c1
Sequence:CCGGCTGGTGTTCATCATCGTGGTACTCGAGTACCACGATGATGAACACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004148.2-458s1c1
Sequence:CCGGCGTGGTAGTCAACATCTTCATCTCGAGATGAAGATGTTGACTACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004148
VALIDATED
NINJ1 MISSION shRNA Lentiviral Transduction Particles
ninjurin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004148.3-444s21c1
Sequence:CCGGCTGGTGTTCATCATCGTGGTACTCGAGTACCACGATGATGAACACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004148.3-458s21c1
Sequence:CCGGCGTGGTAGTCAACATCTTCATCTCGAGATGAAGATGTTGACTACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004148.3-371s21c1
Sequence:CCGGCCTTGTCAAGTACGACCTTAACTCGAGTTAAGGTCGTACTTGACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004148.3-224s21c1
Sequence:CCGGGCTGGACATCGCGCTGCTGATCTCGAGATCAGCAGCGCGATGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004148.2-371s1c1
Sequence:CCGGCCTTGTCAAGTACGACCTTAACTCGAGTTAAGGTCGTACTTGACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004148.2-362s1c1
Sequence:CCGGGCTCATCTTCCTTGTCAAGTACTCGAGTACTTGACAAGGAAGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004148.2-224s1c1
Sequence:CCGGGCTGGACATCGCGCTGCTGATCTCGAGATCAGCAGCGCGATGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004148.2-444s1c1
Sequence:CCGGCTGGTGTTCATCATCGTGGTACTCGAGTACCACGATGATGAACACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004148.2-458s1c1
Sequence:CCGGCGTGGTAGTCAACATCTTCATCTCGAGATGAAGATGTTGACTACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)