EMAIL THIS PAGE TO A FRIEND

NINJ2

ninjurin 2

47 Gene Product Result for
UniProtKB ID: Q9NZG7
Gene ID:
Human(4815) Summary: The protein encoded by this gene belongs to the ninjurin (for nerve injury induced) family. It is a cell surface adhesion protein that is upregulated in Schwann cells surrounding the distal segment of injured nerve, and promotes neurite outgrowth, thus may have a role in nerve regeneration after nerve injury. [provided by RefSeq, Oct 2011]
Mouse(29862) ninjurin 2
Rat(59115) ninjurin 2
sheep(101120483) ninjurin 2
Zebrafish(799267) ninjurin 2
dog(611886) ninjurin 2
cow(509556) ninjurin 2
chicken(418151) ninjurin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016718 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016718 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016718 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016533 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016533 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016533 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036691 MISSION® esiRNA esiRNA human NINJ2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016533 Rosetta Predictions human pricing
NM_021595 Rosetta Predictions rat pricing
NM_016718 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069642 predicted 346
2 SASI_Hs01_00069644 predicted 488
3 SASI_Hs01_00069645 predicted 389
4 SASI_Hs01_00069646 predicted 524
5 SASI_Hs01_00069647 predicted 491
6 SASI_Hs01_00069648 predicted 639
7 SASI_Hs01_00069649 predicted 242
8 SASI_Hs02_00349639 predicted 744
9 SASI_Hs01_00069650 predicted 202
10 SASI_Hs01_00069651 predicted 748
11 SASI_Hs01_00069643 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021595 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119324 predicted 424
2 SASI_Rn01_00119325 predicted 620
3 SASI_Rn02_00262635 predicted 246
4 SASI_Rn02_00262636 predicted 257
5 SASI_Rn01_00119326 predicted 595
6 SASI_Rn01_00119327 predicted 397
7 SASI_Rn01_00119330 predicted 553
8 SASI_Rn01_00119331 predicted 614
9 SASI_Rn02_00262637 predicted 267
10 SASI_Rn02_00262638 predicted 544
11 SASI_Rn01_00119322 predicted 248
12 SASI_Rn01_00119323 predicted 405
13 SASI_Rn01_00119328 predicted 309
14 SASI_Rn01_00119329 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016718 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166221 predicted 242
2 SASI_Mm01_00166222 predicted 220
3 SASI_Mm01_00166224 predicted 460
4 SASI_Mm01_00166226 predicted 519
5 SASI_Mm01_00166227 predicted 572
6 SASI_Mm01_00166229 predicted 333
7 SASI_Mm01_00166230 predicted 462
8 SASI_Mm02_00323409 predicted 329
9 SASI_Mm02_00323410 predicted 328
10 SASI_Mm02_00323411 predicted 563
11 SASI_Mm01_00166223 predicted 360
12 SASI_Mm01_00166225 predicted 204
13 SASI_Mm01_00166228 predicted 574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016718
NINJ2 MISSION shRNA Bacterial Glycerol Stock
ninjurin 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016718.2-575s21c1
Sequence:CCGGCTTCAAGGGCTACGAAGAAACCTCGAGGTTTCTTCGTAGCCCTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016718.2-333s21c1
Sequence:CCGGTAGAGAACCAGAGGCATTTAACTCGAGTTAAATGCCTCTGGTTCTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016718.1-559s1c1
Sequence:CCGGCCTGACTTGTCAGGATAACTACTCGAGTAGTTATCCTGACAAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016718.1-202s1c1
Sequence:CCGGGCTCTTTATGTCCAATGCCATCTCGAGATGGCATTGGACATAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016718.1-401s1c1
Sequence:CCGGGCCACCATCTTGGTCTTCATACTCGAGTATGAAGACCAAGATGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016718.1-325s1c1
Sequence:CCGGCCTTCTTGTGTTCATCGCCATCTCGAGATGGCGATGAACACAAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016718.2-457s21c1
Sequence:CCGGGACCTCCAGCAATCCTATTTGCTCGAGCAAATAGGATTGCTGGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016718
NINJ2 MISSION shRNA shRNA Plasmid DNA
ninjurin 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016718.2-575s21c1
Sequence:CCGGCTTCAAGGGCTACGAAGAAACCTCGAGGTTTCTTCGTAGCCCTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016718.2-333s21c1
Sequence:CCGGTAGAGAACCAGAGGCATTTAACTCGAGTTAAATGCCTCTGGTTCTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016718.1-559s1c1
Sequence:CCGGCCTGACTTGTCAGGATAACTACTCGAGTAGTTATCCTGACAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016718.1-202s1c1
Sequence:CCGGGCTCTTTATGTCCAATGCCATCTCGAGATGGCATTGGACATAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016718.1-401s1c1
Sequence:CCGGGCCACCATCTTGGTCTTCATACTCGAGTATGAAGACCAAGATGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016718.1-325s1c1
Sequence:CCGGCCTTCTTGTGTTCATCGCCATCTCGAGATGGCGATGAACACAAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016718.2-457s21c1
Sequence:CCGGGACCTCCAGCAATCCTATTTGCTCGAGCAAATAGGATTGCTGGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016718
NINJ2 MISSION shRNA Lentiviral Transduction Particles
ninjurin 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016718.2-575s21c1
Sequence:CCGGCTTCAAGGGCTACGAAGAAACCTCGAGGTTTCTTCGTAGCCCTTGAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000428603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016718.2-333s21c1
Sequence:CCGGTAGAGAACCAGAGGCATTTAACTCGAGTTAAATGCCTCTGGTTCTCTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000108450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016718.1-559s1c1
Sequence:CCGGCCTGACTTGTCAGGATAACTACTCGAGTAGTTATCCTGACAAGTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000108451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016718.1-202s1c1
Sequence:CCGGGCTCTTTATGTCCAATGCCATCTCGAGATGGCATTGGACATAAAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000108454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016718.1-401s1c1
Sequence:CCGGGCCACCATCTTGGTCTTCATACTCGAGTATGAAGACCAAGATGGTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000108452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016718.1-325s1c1
Sequence:CCGGCCTTCTTGTGTTCATCGCCATCTCGAGATGGCGATGAACACAAGAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000438425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016718.2-457s21c1
Sequence:CCGGGACCTCCAGCAATCCTATTTGCTCGAGCAAATAGGATTGCTGGAGGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016533
NINJ2 MISSION shRNA Bacterial Glycerol Stock
ninjurin 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016533.4-481s1c1
Sequence:CCGGCGTGGTCATTGCACGGCTGAACTCGAGTTCAGCCGTGCAATGACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016533.4-352s1c1
Sequence:CCGGCCTGTTCATGTCCAACGCCATCTCGAGATGGCGTTGGACATGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016533.4-497s1c1
Sequence:CCGGCTGAACCTGAATGAGGTAGAACTCGAGTTCTACCTCATTCAGGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016533.4-249s1c1
Sequence:CCGGACATCGACCTTCAACCTGGAACTCGAGTTCCAGGTTGAAGGTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016533.4-222s1c1
Sequence:CCGGGCAGCGAGATGGAATCAGCAACTCGAGTTGCTGATTCCATCTCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016533
NINJ2 MISSION shRNA shRNA Plasmid DNA
ninjurin 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016533.4-481s1c1
Sequence:CCGGCGTGGTCATTGCACGGCTGAACTCGAGTTCAGCCGTGCAATGACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016533.4-352s1c1
Sequence:CCGGCCTGTTCATGTCCAACGCCATCTCGAGATGGCGTTGGACATGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016533.4-497s1c1
Sequence:CCGGCTGAACCTGAATGAGGTAGAACTCGAGTTCTACCTCATTCAGGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016533.4-249s1c1
Sequence:CCGGACATCGACCTTCAACCTGGAACTCGAGTTCCAGGTTGAAGGTCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016533.4-222s1c1
Sequence:CCGGGCAGCGAGATGGAATCAGCAACTCGAGTTGCTGATTCCATCTCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016533
NINJ2 MISSION shRNA Lentiviral Transduction Particles
ninjurin 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016533.4-481s1c1
Sequence:CCGGCGTGGTCATTGCACGGCTGAACTCGAGTTCAGCCGTGCAATGACCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016533.4-352s1c1
Sequence:CCGGCCTGTTCATGTCCAACGCCATCTCGAGATGGCGTTGGACATGAACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016533.4-497s1c1
Sequence:CCGGCTGAACCTGAATGAGGTAGAACTCGAGTTCTACCTCATTCAGGTTCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016533.4-249s1c1
Sequence:CCGGACATCGACCTTCAACCTGGAACTCGAGTTCCAGGTTGAAGGTCGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016533.4-222s1c1
Sequence:CCGGGCAGCGAGATGGAATCAGCAACTCGAGTTGCTGATTCCATCTCGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???