EMAIL THIS PAGE TO A FRIEND

NINL

ninein-like

56 Gene Product Result for
Synonyms: NLP dJ691N24.1
Gene ID:
Mouse(78177) ninein-like
Rat(311529) ninein-like
Zebrafish(561921) ninein-like
dog(477006) ninein-like
sheep(101106868) ninein-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA000686 Anti-NINL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025176 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207204 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207204 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207204 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025176 Rosetta Predictions human pricing
XM_001060198 Rosetta Predictions rat pricing
XM_230778 Rosetta Predictions rat pricing
NM_207204 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122418 predicted 4208
2 SASI_Hs01_00122419 predicted 1937
3 SASI_Hs01_00122420 predicted 4236
4 SASI_Hs01_00122421 predicted 3989
5 SASI_Hs01_00122422 predicted 230
6 SASI_Hs02_00357927 predicted 421
7 SASI_Hs01_00122424 predicted 856
8 SASI_Hs01_00122425 predicted 1015
9 SASI_Hs01_00122426 predicted 546
10 SASI_Hs01_00122427 predicted 3293
11 SASI_Hs01_00122423 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295700 predicted 3124
2 SASI_Rn02_00295701 predicted 961
3 SASI_Rn02_00295702 predicted 2959
4 SASI_Rn02_00295703 predicted 4289
5 SASI_Rn02_00295704 predicted 2455
6 SASI_Rn02_00295705 predicted 4130
7 SASI_Rn02_00295706 predicted 3353
8 SASI_Rn02_00295707 predicted 3250
9 SASI_Rn02_00295708 predicted 2748
10 SASI_Rn02_00295709 predicted 3371
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386432 predicted 3125
2 SASI_Rn02_00386433 predicted 959
3 SASI_Rn02_00386434 predicted 2959
4 SASI_Rn02_00386435 predicted 4286
5 SASI_Rn02_00386436 predicted 2449
6 SASI_Rn02_00386437 predicted 2048
7 SASI_Rn02_00386438 predicted 4125
8 SASI_Rn02_00386439 predicted 3354
9 SASI_Rn02_00386440 predicted 3258
10 SASI_Rn02_00386441 predicted 2751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207204 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351925 predicted 3426
2 SASI_Mm01_00189689 predicted 1988
3 SASI_Mm01_00189690 predicted 1012
4 SASI_Mm01_00189692 predicted 4185
5 SASI_Mm01_00189693 predicted 668
6 SASI_Mm01_00189694 predicted 4236
7 SASI_Mm01_00189695 predicted 2907
8 SASI_Mm01_00189696 predicted 2214
9 SASI_Mm01_00189697 predicted 724
10 SASI_Mm01_00189698 predicted 2731
11 SASI_Mm01_00189691 predicted 2051
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025176
VALIDATED
NINL MISSION shRNA Bacterial Glycerol Stock
ninein-like
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-227s21c1
Sequence:CCGGGCTTCTCGGAAACGACCATTTCTCGAGAAATGGTCGTTTCCGAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025176.4-4438s21c1
Sequence:CCGGATTAGCGGTCCTGAGTAATTTCTCGAGAAATTACTCAGGACCGCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-254s21c1
Sequence:CCGGGGTTAACTTTGAGGAATTTAACTCGAGTTAAATTCCTCAAAGTTAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_025176.3-778s1c1
Sequence:CCGGGCAAAGTGAGTCTTGAGGAATCTCGAGATTCCTCAAGACTCACTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025176.3-1939s1c1
Sequence:CCGGCCAAGGTAAATTACTACGAAACTCGAGTTTCGTAGTAATTTACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025176.3-3944s1c1
Sequence:CCGGCCTCCAAGAGAAAGTGGATAACTCGAGTTATCCACTTTCTCTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025176.3-271s1c1
Sequence:CCGGCCTCAGATGAAGACAGTAGTTCTCGAGAACTACTGTCTTCATCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025176.3-3536s1c1
Sequence:CCGGGCATCGTGTGACCATTCAGATCTCGAGATCTGAATGGTCACACGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025176.4-4634s21c1
Sequence:CCGGTGCTTTAAGCTTAGCTTATTACTCGAGTAATAAGCTAAGCTTAAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-911s21c1
Sequence:CCGGGAGCAAGGCTTGGTCTCATTACTCGAGTAATGAGACCAAGCCTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-3501s21c1
Sequence:CCGGCAGAACTACAAGGATCAATTACTCGAGTAATTGATCCTTGTAGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-1886s21c1
Sequence:CCGGCATTTCATTCCTGGGTAATTCCTCGAGGAATTACCCAGGAATGAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-888s21c1
Sequence:CCGGGAGTCTTCCACTCGGGTTAAACTCGAGTTTAACCCGAGTGGAAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025176
VALIDATED
NINL MISSION shRNA shRNA Plasmid DNA
ninein-like
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-227s21c1
Sequence:CCGGGCTTCTCGGAAACGACCATTTCTCGAGAAATGGTCGTTTCCGAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025176.4-4438s21c1
Sequence:CCGGATTAGCGGTCCTGAGTAATTTCTCGAGAAATTACTCAGGACCGCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-254s21c1
Sequence:CCGGGGTTAACTTTGAGGAATTTAACTCGAGTTAAATTCCTCAAAGTTAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_025176.3-778s1c1
Sequence:CCGGGCAAAGTGAGTCTTGAGGAATCTCGAGATTCCTCAAGACTCACTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025176.3-1939s1c1
Sequence:CCGGCCAAGGTAAATTACTACGAAACTCGAGTTTCGTAGTAATTTACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025176.3-3944s1c1
Sequence:CCGGCCTCCAAGAGAAAGTGGATAACTCGAGTTATCCACTTTCTCTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025176.3-271s1c1
Sequence:CCGGCCTCAGATGAAGACAGTAGTTCTCGAGAACTACTGTCTTCATCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025176.3-3536s1c1
Sequence:CCGGGCATCGTGTGACCATTCAGATCTCGAGATCTGAATGGTCACACGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025176.4-4634s21c1
Sequence:CCGGTGCTTTAAGCTTAGCTTATTACTCGAGTAATAAGCTAAGCTTAAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-911s21c1
Sequence:CCGGGAGCAAGGCTTGGTCTCATTACTCGAGTAATGAGACCAAGCCTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-3501s21c1
Sequence:CCGGCAGAACTACAAGGATCAATTACTCGAGTAATTGATCCTTGTAGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-1886s21c1
Sequence:CCGGCATTTCATTCCTGGGTAATTCCTCGAGGAATTACCCAGGAATGAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-888s21c1
Sequence:CCGGGAGTCTTCCACTCGGGTTAAACTCGAGTTTAACCCGAGTGGAAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025176
VALIDATED
NINL MISSION shRNA Lentiviral Transduction Particles
ninein-like
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-227s21c1
Sequence:CCGGGCTTCTCGGAAACGACCATTTCTCGAGAAATGGTCGTTTCCGAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025176.4-4438s21c1
Sequence:CCGGATTAGCGGTCCTGAGTAATTTCTCGAGAAATTACTCAGGACCGCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-254s21c1
Sequence:CCGGGGTTAACTTTGAGGAATTTAACTCGAGTTAAATTCCTCAAAGTTAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_025176.3-778s1c1
Sequence:CCGGGCAAAGTGAGTCTTGAGGAATCTCGAGATTCCTCAAGACTCACTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025176.3-1939s1c1
Sequence:CCGGCCAAGGTAAATTACTACGAAACTCGAGTTTCGTAGTAATTTACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025176.3-3944s1c1
Sequence:CCGGCCTCCAAGAGAAAGTGGATAACTCGAGTTATCCACTTTCTCTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025176.3-271s1c1
Sequence:CCGGCCTCAGATGAAGACAGTAGTTCTCGAGAACTACTGTCTTCATCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025176.3-3536s1c1
Sequence:CCGGGCATCGTGTGACCATTCAGATCTCGAGATCTGAATGGTCACACGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025176.4-4634s21c1
Sequence:CCGGTGCTTTAAGCTTAGCTTATTACTCGAGTAATAAGCTAAGCTTAAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-911s21c1
Sequence:CCGGGAGCAAGGCTTGGTCTCATTACTCGAGTAATGAGACCAAGCCTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-3501s21c1
Sequence:CCGGCAGAACTACAAGGATCAATTACTCGAGTAATTGATCCTTGTAGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-1886s21c1
Sequence:CCGGCATTTCATTCCTGGGTAATTCCTCGAGGAATTACCCAGGAATGAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025176.4-888s21c1
Sequence:CCGGGAGTCTTCCACTCGGGTTAAACTCGAGTTTAACCCGAGTGGAAGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207204
NINL MISSION shRNA Bacterial Glycerol Stock
ninein-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207204.1-2876s1c1
Sequence:CCGGGCTCTGTAGTATAGATGCCATCTCGAGATGGCATCTATACTACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207204.1-3940s1c1
Sequence:CCGGGCAAAGAACAATGGAGAGAAACTCGAGTTTCTCTCCATTGTTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207204.1-1195s1c1
Sequence:CCGGCCCTTGACAATGAACTGCTAACTCGAGTTAGCAGTTCATTGTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207204.1-1760s1c1
Sequence:CCGGCCTGAACGATTATGAGCTTAACTCGAGTTAAGCTCATAATCGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207204.1-1194s1c1
Sequence:CCGGGCCCTTGACAATGAACTGCTACTCGAGTAGCAGTTCATTGTCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207204
NINL MISSION shRNA shRNA Plasmid DNA
ninein-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207204.1-2876s1c1
Sequence:CCGGGCTCTGTAGTATAGATGCCATCTCGAGATGGCATCTATACTACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207204.1-3940s1c1
Sequence:CCGGGCAAAGAACAATGGAGAGAAACTCGAGTTTCTCTCCATTGTTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207204.1-1195s1c1
Sequence:CCGGCCCTTGACAATGAACTGCTAACTCGAGTTAGCAGTTCATTGTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207204.1-1760s1c1
Sequence:CCGGCCTGAACGATTATGAGCTTAACTCGAGTTAAGCTCATAATCGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207204.1-1194s1c1
Sequence:CCGGGCCCTTGACAATGAACTGCTACTCGAGTAGCAGTTCATTGTCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207204
NINL MISSION shRNA Lentiviral Transduction Particles
ninein-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207204.1-2876s1c1
Sequence:CCGGGCTCTGTAGTATAGATGCCATCTCGAGATGGCATCTATACTACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207204.1-3940s1c1
Sequence:CCGGGCAAAGAACAATGGAGAGAAACTCGAGTTTCTCTCCATTGTTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207204.1-1195s1c1
Sequence:CCGGCCCTTGACAATGAACTGCTAACTCGAGTTAGCAGTTCATTGTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207204.1-1760s1c1
Sequence:CCGGCCTGAACGATTATGAGCTTAACTCGAGTTAAGCTCATAATCGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207204.1-1194s1c1
Sequence:CCGGGCCCTTGACAATGAACTGCTACTCGAGTAGCAGTTCATTGTCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)