EMAIL THIS PAGE TO A FRIEND

NIP7

NIP7, nucleolar pre-rRNA processing protein

89 Gene Product Result for
Synonyms: HSPC031 KD93
UniProtKB ID: Q9Y221, B2RD04, Q9NZZ0
Gene ID:
Mouse(66164) nuclear import 7 homolog (S. cerevisiae)
Rat(192180) NIP7, nucleolar pre-rRNA processing protein
Zebrafish(553616) nuclear import 7 homolog (S. cerevisiae)
domestic cat(101096776) nuclear import 7 homolog (S. cerevisiae)
cow(509981) nuclear import 7 homolog (S. cerevisiae)
dog(479673) nuclear import 7 homolog (S. cerevisiae)
chicken(415863) nuclear import 7 homolog (S. cerevisiae)
domestic guinea pig(100724109) NIP7, nucleolar pre-rRNA processing protein
naked mole-rat(101714818) NIP7, nucleolar pre-rRNA processing protein
sheep(101120941) nuclear import 7 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40832 Anti-NIP7 (AB1) antibody produced in rabbit affinity isolated antibody human, horse, zebrafish, guinea pig, pig, mouse, rat, bovine, rabbit
immunohistochemistry, western blot pricing
AV40833 Anti-NIP7 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, canine, guinea pig, human, pig, horse, zebrafish, rat, rabbit, bovine
immunohistochemistry, western blot pricing
SAB1409421 Anti-NIP7 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA059850 Anti-NIP7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
HPA040856 Anti-NIP7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016101 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016101 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016101 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016101 Rosetta Predictions human pricing
NM_138847 Rosetta Predictions rat pricing
NM_025391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041597 predicted 706
2 SASI_Hs01_00041599 predicted 842
3 SASI_Hs01_00041600 predicted 875
4 SASI_Hs01_00041601 predicted 659
5 SASI_Hs02_00348872 predicted 868
6 SASI_Hs02_00348873 predicted 869
7 SASI_Hs01_00041604 predicted 616
8 SASI_Hs01_00041605 predicted 221
9 SASI_Hs01_00041606 predicted 936
10 SASI_Hs02_00348874 predicted 856
11 SASI_Hs01_00041598 predicted 457
12 SASI_Hs01_00041602 predicted 458
13 SASI_Hs01_00041603 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043734 predicted 363
2 SASI_Rn01_00043735 predicted 881
3 SASI_Rn01_00043736 predicted 802
4 SASI_Rn01_00043737 predicted 211
5 SASI_Rn01_00043738 predicted 607
6 SASI_Rn01_00043739 predicted 565
7 SASI_Rn01_00043740 predicted 721
8 SASI_Rn01_00043741 predicted 310
9 SASI_Rn01_00043742 predicted 627
10 SASI_Rn01_00043743 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328123 predicted 369
2 SASI_Mm01_00045874 predicted 1081
3 SASI_Mm02_00328124 predicted 1069
4 SASI_Mm01_00045876 predicted 583
5 SASI_Mm01_00045878 predicted 234
6 SASI_Mm02_00328125 predicted 1077
7 SASI_Mm02_00328126 predicted 262
8 SASI_Mm02_00328127 predicted 592
9 SASI_Mm02_00328128 predicted 530
10 SASI_Mm02_00328129 predicted 221
11 SASI_Mm01_00045872 predicted 686
12 SASI_Mm01_00045873 predicted 1052
13 SASI_Mm01_00045875 predicted 986
14 SASI_Mm01_00045877 predicted 637
15 SASI_Mm01_00045879 predicted 887
16 SASI_Mm01_00045880 predicted 698
17 SASI_Mm01_00045881 predicted 1053
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016101
NIP7 MISSION shRNA Bacterial Glycerol Stock
NIP7, nucleolar pre-rRNA processing protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016101.2-636s1c1
Sequence:CCGGGCGATTGTGGTATTTCATCAACTCGAGTTGATGAAATACCACAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-680s1c1
Sequence:CCGGGCATGAAGAGACGTTGACTTACTCGAGTAAGTCAACGTCTCTTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016101.2-630s1c1
Sequence:CCGGCCCATGGCGATTGTGGTATTTCTCGAGAAATACCACAATCGCCATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-224s1c1
Sequence:CCGGGAATCTTCAACTGCTGGTGGACTCGAGTCCACCAGCAGTTGAAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-594s1c1
Sequence:CCGGGCAGCCAAATCTACACAAGACCTCGAGGTCTTGTGTAGATTTGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-185s1c1
Sequence:CCGGCCGTGTCATGTTTGAGAAGATCTCGAGATCTTCTCAAACATGACACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016101.2-414s1c1
Sequence:CCGGCTGGATTACCTTGCACCTTATCTCGAGATAAGGTGCAAGGTAATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016101.2-186s1c1
Sequence:CCGGCGTGTCATGTTTGAGAAGATACTCGAGTATCTTCTCAAACATGACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016101.2-198s1c1
Sequence:CCGGGAGAAGATAGCGAAGTACATTCTCGAGAATGTACTTCGCTATCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-191s1c1
Sequence:CCGGCATGTTTGAGAAGATAGCGAACTCGAGTTCGCTATCTTCTCAAACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-194s1c1
Sequence:CCGGGTTTGAGAAGATAGCGAAGTACTCGAGTACTTCGCTATCTTCTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016101
NIP7 MISSION shRNA shRNA Plasmid DNA
NIP7, nucleolar pre-rRNA processing protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016101.2-636s1c1
Sequence:CCGGGCGATTGTGGTATTTCATCAACTCGAGTTGATGAAATACCACAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-680s1c1
Sequence:CCGGGCATGAAGAGACGTTGACTTACTCGAGTAAGTCAACGTCTCTTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016101.2-630s1c1
Sequence:CCGGCCCATGGCGATTGTGGTATTTCTCGAGAAATACCACAATCGCCATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-224s1c1
Sequence:CCGGGAATCTTCAACTGCTGGTGGACTCGAGTCCACCAGCAGTTGAAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-594s1c1
Sequence:CCGGGCAGCCAAATCTACACAAGACCTCGAGGTCTTGTGTAGATTTGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-185s1c1
Sequence:CCGGCCGTGTCATGTTTGAGAAGATCTCGAGATCTTCTCAAACATGACACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016101.2-414s1c1
Sequence:CCGGCTGGATTACCTTGCACCTTATCTCGAGATAAGGTGCAAGGTAATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016101.2-186s1c1
Sequence:CCGGCGTGTCATGTTTGAGAAGATACTCGAGTATCTTCTCAAACATGACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016101.2-198s1c1
Sequence:CCGGGAGAAGATAGCGAAGTACATTCTCGAGAATGTACTTCGCTATCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-191s1c1
Sequence:CCGGCATGTTTGAGAAGATAGCGAACTCGAGTTCGCTATCTTCTCAAACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-194s1c1
Sequence:CCGGGTTTGAGAAGATAGCGAAGTACTCGAGTACTTCGCTATCTTCTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016101
NIP7 MISSION shRNA Lentiviral Transduction Particles
NIP7, nucleolar pre-rRNA processing protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016101.2-636s1c1
Sequence:CCGGGCGATTGTGGTATTTCATCAACTCGAGTTGATGAAATACCACAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-680s1c1
Sequence:CCGGGCATGAAGAGACGTTGACTTACTCGAGTAAGTCAACGTCTCTTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016101.2-630s1c1
Sequence:CCGGCCCATGGCGATTGTGGTATTTCTCGAGAAATACCACAATCGCCATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-224s1c1
Sequence:CCGGGAATCTTCAACTGCTGGTGGACTCGAGTCCACCAGCAGTTGAAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-594s1c1
Sequence:CCGGGCAGCCAAATCTACACAAGACCTCGAGGTCTTGTGTAGATTTGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-185s1c1
Sequence:CCGGCCGTGTCATGTTTGAGAAGATCTCGAGATCTTCTCAAACATGACACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016101.2-414s1c1
Sequence:CCGGCTGGATTACCTTGCACCTTATCTCGAGATAAGGTGCAAGGTAATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016101.2-186s1c1
Sequence:CCGGCGTGTCATGTTTGAGAAGATACTCGAGTATCTTCTCAAACATGACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016101.2-198s1c1
Sequence:CCGGGAGAAGATAGCGAAGTACATTCTCGAGAATGTACTTCGCTATCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-191s1c1
Sequence:CCGGCATGTTTGAGAAGATAGCGAACTCGAGTTCGCTATCTTCTCAAACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016101.2-194s1c1
Sequence:CCGGGTTTGAGAAGATAGCGAAGTACTCGAGTACTTCGCTATCTTCTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025391
VALIDATED
NIP7 MISSION shRNA Bacterial Glycerol Stock
NIP7, nucleolar pre-rRNA processing protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025391.1-106s1c1
Sequence:CCGGCGCGAAGTACATCGGAGAGAACTCGAGTTCTCTCCGATGTACTTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025391.1-337s1c1
Sequence:CCGGCAAGTATAAAGTGTGGGTAAACTCGAGTTTACCCACACTTTATACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025391.1-336s1c1
Sequence:CCGGCCAAGTATAAAGTGTGGGTAACTCGAGTTACCCACACTTTATACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025391.1-370s1c1
Sequence:CCGGGCAGTCCTTCTTGTATGGAAACTCGAGTTTCCATACAAGAAGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025391.1-947s1c1
Sequence:CCGGGCTCTGAGTGATGGTTTCTAACTCGAGTTAGAAACCATCACTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025391.1-456s21c1
Sequence:CCGGTCTATTCCATGGCGGACATTCCTCGAGGAATGTCCGCCATGGAATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025391.1-106s21c1
Sequence:CCGGCGCGAAGTACATCGGAGAGAACTCGAGTTCTCTCCGATGTACTTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025391.1-947s21c1
Sequence:CCGGGCTCTGAGTGATGGTTTCTAACTCGAGTTAGAAACCATCACTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025391.1-370s21c1
Sequence:CCGGGCAGTCCTTCTTGTATGGAAACTCGAGTTTCCATACAAGAAGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025391
VALIDATED
NIP7 MISSION shRNA shRNA Plasmid DNA
NIP7, nucleolar pre-rRNA processing protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025391.1-106s1c1
Sequence:CCGGCGCGAAGTACATCGGAGAGAACTCGAGTTCTCTCCGATGTACTTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025391.1-337s1c1
Sequence:CCGGCAAGTATAAAGTGTGGGTAAACTCGAGTTTACCCACACTTTATACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025391.1-336s1c1
Sequence:CCGGCCAAGTATAAAGTGTGGGTAACTCGAGTTACCCACACTTTATACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025391.1-370s1c1
Sequence:CCGGGCAGTCCTTCTTGTATGGAAACTCGAGTTTCCATACAAGAAGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025391.1-947s1c1
Sequence:CCGGGCTCTGAGTGATGGTTTCTAACTCGAGTTAGAAACCATCACTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025391.1-456s21c1
Sequence:CCGGTCTATTCCATGGCGGACATTCCTCGAGGAATGTCCGCCATGGAATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025391.1-106s21c1
Sequence:CCGGCGCGAAGTACATCGGAGAGAACTCGAGTTCTCTCCGATGTACTTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025391.1-947s21c1
Sequence:CCGGGCTCTGAGTGATGGTTTCTAACTCGAGTTAGAAACCATCACTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025391.1-370s21c1
Sequence:CCGGGCAGTCCTTCTTGTATGGAAACTCGAGTTTCCATACAAGAAGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025391
VALIDATED
NIP7 MISSION shRNA Lentiviral Transduction Particles
NIP7, nucleolar pre-rRNA processing protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025391.1-106s1c1
Sequence:CCGGCGCGAAGTACATCGGAGAGAACTCGAGTTCTCTCCGATGTACTTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025391.1-337s1c1
Sequence:CCGGCAAGTATAAAGTGTGGGTAAACTCGAGTTTACCCACACTTTATACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025391.1-336s1c1
Sequence:CCGGCCAAGTATAAAGTGTGGGTAACTCGAGTTACCCACACTTTATACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025391.1-370s1c1
Sequence:CCGGGCAGTCCTTCTTGTATGGAAACTCGAGTTTCCATACAAGAAGGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025391.1-947s1c1
Sequence:CCGGGCTCTGAGTGATGGTTTCTAACTCGAGTTAGAAACCATCACTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025391.1-456s21c1
Sequence:CCGGTCTATTCCATGGCGGACATTCCTCGAGGAATGTCCGCCATGGAATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025391.1-106s21c1
Sequence:CCGGCGCGAAGTACATCGGAGAGAACTCGAGTTCTCTCCGATGTACTTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025391.1-947s21c1
Sequence:CCGGGCTCTGAGTGATGGTTTCTAACTCGAGTTAGAAACCATCACTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025391.1-370s21c1
Sequence:CCGGGCAGTCCTTCTTGTATGGAAACTCGAGTTTCCATACAAGAAGGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)