EMAIL THIS PAGE TO A FRIEND

NIPA1

non imprinted in Prader-Willi/Angelman syndrome 1

147 Gene Product Result for
Synonyms: FSP3 SPG6
UniProtKB ID: Q7RTP0, B2RA76, Q5HYA9, Q7KZB0, Q86XW4
Gene ID:
Human(123606) Summary: This gene encodes a magnesium transporter that associates with early endosomes and the cell surface in a variety of neuronal and epithelial cells. This protein may play a role in nervous system development and maintenance. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene have been associated with autosomal dominant spastic paraplegia 6. [provided by RefSeq, Nov 2008]
Mouse(233280) non imprinted in Prader-Willi/Angelman syndrome 1 homolog (human)
Rat(308668) non imprinted in Prader-Willi/Angelman syndrome 1
Zebrafish(450042) non imprinted in Prader-Willi/Angelman syndrome 1
chicken(418681) non imprinted in Prader-Willi/Angelman syndrome 1
domestic cat(101090753) non imprinted in Prader-Willi/Angelman syndrome 1
cow(539162) non imprinted in Prader-Willi/Angelman syndrome 1
dog(488681) non imprinted in Prader-Willi/Angelman syndrome 1
sheep(101102783) non imprinted in Prader-Willi/Angelman syndrome 1
naked mole-rat(101714525) non imprinted in Prader-Willi/Angelman syndrome 1
domestic guinea pig(100731056) non imprinted in Prader-Willi/Angelman syndrome 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153578 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153578 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153578 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144599 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144599 Rosetta Predictions human pricing
NM_001107519 Rosetta Predictions rat pricing
NM_153578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246821 predicted 1099
2 SASI_Hs01_00246822 predicted 1073
3 SASI_Hs01_00246823 predicted 1091
4 SASI_Hs01_00246825 predicted 939
5 SASI_Hs02_00364396 predicted 985
6 SASI_Hs02_00364397 predicted 450
7 SASI_Hs01_00246827 predicted 942
8 SASI_Hs02_00364398 predicted 1277
9 SASI_Hs01_00246828 predicted 1021
10 SASI_Hs01_00246829 predicted 808
11 SASI_Hs01_00246824 predicted 1340
12 SASI_Hs01_00246826 predicted 455
13 SASI_Hs01_00246830 predicted 1348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107519 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229625 predicted 1029
2 SASI_Rn02_00229626 predicted 890
3 SASI_Rn02_00229627 predicted 1206
4 SASI_Rn02_00229628 predicted 1150
5 SASI_Rn02_00229629 predicted 834
6 SASI_Rn02_00229630 predicted 535
7 SASI_Rn02_00229631 predicted 1068
8 SASI_Rn02_00229632 predicted 897
9 SASI_Rn02_00229633 predicted 770
10 SASI_Rn02_00229634 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179441 predicted 938
2 SASI_Mm02_00343385 predicted 1056
3 SASI_Mm01_00179442 predicted 1270
4 SASI_Mm01_00179443 predicted 891
5 SASI_Mm01_00179445 predicted 834
6 SASI_Mm01_00179447 predicted 350
7 SASI_Mm01_00179448 predicted 1144
8 SASI_Mm01_00179449 predicted 942
9 SASI_Mm01_00179450 predicted 888
10 SASI_Mm02_00343386 predicted 273
11 SASI_Mm01_00179444 predicted 945
12 SASI_Mm01_00179446 predicted 1160
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153578
NIPA1 MISSION shRNA Bacterial Glycerol Stock
non imprinted in Prader-Willi/Angelman syndrome 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153578.1-903s1c1
Sequence:CCGGGTCCTCATACAAGTGTTCAAACTCGAGTTTGAACACTTGTATGAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153578.1-771s1c1
Sequence:CCGGGCCATCTACTACGTTGTGTTTCTCGAGAAACACAACGTAGTAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153578.1-219s1c1
Sequence:CCGGGTCGGCCAGATTGGAAACTTTCTCGAGAAAGTTTCCAATCTGGCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153578.1-226s1c1
Sequence:CCGGAGATTGGAAACTTTCTAGCTTCTCGAGAAGCTAGAAAGTTTCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153578.1-1419s1c1
Sequence:CCGGCGGTATGTGAATCGAGTTGTTCTCGAGAACAACTCGATTCACATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153578.2-748s21c1
Sequence:CCGGGCTTCGACTCCTCTGTATTTGCTCGAGCAAATACAGAGGAGTCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153578.2-292s21c1
Sequence:CCGGGAGTACCGTTTGGGTCCATTTCTCGAGAAATGGACCCAAACGGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153578.2-1206s21c1
Sequence:CCGGTTAACCTAGAAGCTTTCATTCCTCGAGGAATGAAAGCTTCTAGGTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153578.2-1068s21c1
Sequence:CCGGGCATTGCCTGTGAACTAATAACTCGAGTTATTAGTTCACAGGCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153578
NIPA1 MISSION shRNA shRNA Plasmid DNA
non imprinted in Prader-Willi/Angelman syndrome 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153578.1-903s1c1
Sequence:CCGGGTCCTCATACAAGTGTTCAAACTCGAGTTTGAACACTTGTATGAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153578.1-771s1c1
Sequence:CCGGGCCATCTACTACGTTGTGTTTCTCGAGAAACACAACGTAGTAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153578.1-219s1c1
Sequence:CCGGGTCGGCCAGATTGGAAACTTTCTCGAGAAAGTTTCCAATCTGGCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153578.1-226s1c1
Sequence:CCGGAGATTGGAAACTTTCTAGCTTCTCGAGAAGCTAGAAAGTTTCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153578.1-1419s1c1
Sequence:CCGGCGGTATGTGAATCGAGTTGTTCTCGAGAACAACTCGATTCACATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153578.2-748s21c1
Sequence:CCGGGCTTCGACTCCTCTGTATTTGCTCGAGCAAATACAGAGGAGTCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153578.2-292s21c1
Sequence:CCGGGAGTACCGTTTGGGTCCATTTCTCGAGAAATGGACCCAAACGGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153578.2-1206s21c1
Sequence:CCGGTTAACCTAGAAGCTTTCATTCCTCGAGGAATGAAAGCTTCTAGGTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153578.2-1068s21c1
Sequence:CCGGGCATTGCCTGTGAACTAATAACTCGAGTTATTAGTTCACAGGCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153578
NIPA1 MISSION shRNA Lentiviral Transduction Particles
non imprinted in Prader-Willi/Angelman syndrome 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153578.1-903s1c1
Sequence:CCGGGTCCTCATACAAGTGTTCAAACTCGAGTTTGAACACTTGTATGAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153578.1-771s1c1
Sequence:CCGGGCCATCTACTACGTTGTGTTTCTCGAGAAACACAACGTAGTAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153578.1-219s1c1
Sequence:CCGGGTCGGCCAGATTGGAAACTTTCTCGAGAAAGTTTCCAATCTGGCCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153578.1-226s1c1
Sequence:CCGGAGATTGGAAACTTTCTAGCTTCTCGAGAAGCTAGAAAGTTTCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153578.1-1419s1c1
Sequence:CCGGCGGTATGTGAATCGAGTTGTTCTCGAGAACAACTCGATTCACATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153578.2-748s21c1
Sequence:CCGGGCTTCGACTCCTCTGTATTTGCTCGAGCAAATACAGAGGAGTCGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153578.2-292s21c1
Sequence:CCGGGAGTACCGTTTGGGTCCATTTCTCGAGAAATGGACCCAAACGGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153578.2-1206s21c1
Sequence:CCGGTTAACCTAGAAGCTTTCATTCCTCGAGGAATGAAAGCTTCTAGGTTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153578.2-1068s21c1
Sequence:CCGGGCATTGCCTGTGAACTAATAACTCGAGTTATTAGTTCACAGGCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144599
VALIDATED
NIPA1 MISSION shRNA Bacterial Glycerol Stock
non imprinted in Prader-Willi/Angelman syndrome 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144599.4-953s21c1
Sequence:CCGGGTGTTCAAAGAGTTCAATTTCCTCGAGGAAATTGAACTCTTTGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144599.3-937s1c1
Sequence:CCGGGATTGTCCTTATACAGGTGTTCTCGAGAACACCTGTATAAGGACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144599.3-950s1c1
Sequence:CCGGCAGGTGTTCAAAGAGTTCAATCTCGAGATTGAACTCTTTGAACACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_144599.4-810s21c1
Sequence:CCGGCCATCTACTACGTCGTGTTTACTCGAGTAAACACGACGTAGTAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144599.3-3166s1c1
Sequence:CCGGGCCTTAACTTACTGAACTGAACTCGAGTTCAGTTCAGTAAGTTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144599.4-418s21c1
Sequence:CCGGAGGCTCCGTCGTGCTGATTATCTCGAGATAATCAGCACGACGGAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_144599.4-197s21c1
Sequence:CCGGCGGCGAGGTACTTCCTATTTACTCGAGTAAATAGGAAGTACCTCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144599.4-3377s21c1
Sequence:CCGGCTTGGTGTACCTTAGTATATTCTCGAGAATATACTAAGGTACACCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144599
VALIDATED
NIPA1 MISSION shRNA shRNA Plasmid DNA
non imprinted in Prader-Willi/Angelman syndrome 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144599.4-953s21c1
Sequence:CCGGGTGTTCAAAGAGTTCAATTTCCTCGAGGAAATTGAACTCTTTGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144599.3-937s1c1
Sequence:CCGGGATTGTCCTTATACAGGTGTTCTCGAGAACACCTGTATAAGGACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144599.3-950s1c1
Sequence:CCGGCAGGTGTTCAAAGAGTTCAATCTCGAGATTGAACTCTTTGAACACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_144599.4-810s21c1
Sequence:CCGGCCATCTACTACGTCGTGTTTACTCGAGTAAACACGACGTAGTAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144599.3-3166s1c1
Sequence:CCGGGCCTTAACTTACTGAACTGAACTCGAGTTCAGTTCAGTAAGTTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144599.4-418s21c1
Sequence:CCGGAGGCTCCGTCGTGCTGATTATCTCGAGATAATCAGCACGACGGAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_144599.4-197s21c1
Sequence:CCGGCGGCGAGGTACTTCCTATTTACTCGAGTAAATAGGAAGTACCTCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144599.4-3377s21c1
Sequence:CCGGCTTGGTGTACCTTAGTATATTCTCGAGAATATACTAAGGTACACCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144599
VALIDATED
NIPA1 MISSION shRNA Lentiviral Transduction Particles
non imprinted in Prader-Willi/Angelman syndrome 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144599.4-953s21c1
Sequence:CCGGGTGTTCAAAGAGTTCAATTTCCTCGAGGAAATTGAACTCTTTGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144599.3-937s1c1
Sequence:CCGGGATTGTCCTTATACAGGTGTTCTCGAGAACACCTGTATAAGGACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144599.3-950s1c1
Sequence:CCGGCAGGTGTTCAAAGAGTTCAATCTCGAGATTGAACTCTTTGAACACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_144599.4-810s21c1
Sequence:CCGGCCATCTACTACGTCGTGTTTACTCGAGTAAACACGACGTAGTAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144599.3-3166s1c1
Sequence:CCGGGCCTTAACTTACTGAACTGAACTCGAGTTCAGTTCAGTAAGTTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144599.4-418s21c1
Sequence:CCGGAGGCTCCGTCGTGCTGATTATCTCGAGATAATCAGCACGACGGAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_144599.4-197s21c1
Sequence:CCGGCGGCGAGGTACTTCCTATTTACTCGAGTAAATAGGAAGTACCTCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144599.4-3377s21c1
Sequence:CCGGCTTGGTGTACCTTAGTATATTCTCGAGAATATACTAAGGTACACCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)