EMAIL THIS PAGE TO A FRIEND

NIPA2

non imprinted in Prader-Willi/Angelman syndrome 2

102 Gene Product Result for
UniProtKB ID: Q8N8Q9, F8W7Y8, Q96F03, Q9BVS2
Gene ID:
Human(81614) Summary: This gene encodes a possible magnesium transporter. This gene is located adjacent to the imprinted domain in the Prader-Willi syndrome deletion region of chromosome 15. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 7 and 21.[provided by RefSeq, May 2010]
Mouse(93790) non imprinted in Prader-Willi/Angelman syndrome 2 homolog (human)
Rat(308667) non imprinted in Prader-Willi/Angelman syndrome 2
domestic guinea pig(100730302) non imprinted in Prader-Willi/Angelman syndrome 2
naked mole-rat(101714880) non imprinted in Prader-Willi/Angelman syndrome 2
sheep(101103038) non imprinted in Prader-Willi/Angelman syndrome 2
Zebrafish(406399) non imprinted in Prader-Willi/Angelman syndrome 2 (human)
cow(507430) non imprinted in Prader-Willi/Angelman syndrome 2
Horse(100051099) non imprinted in Prader-Willi/Angelman syndrome 2
chicken(418680) non imprinted in Prader-Willi/Angelman syndrome 2
domestic cat(101089997) non imprinted in Prader-Willi/Angelman syndrome 2
dog(479002) non imprinted in Prader-Willi/Angelman syndrome 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030922 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030922 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030922 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023647 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023647 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023647 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071601 MISSION® esiRNA esiRNA human NIPA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008860 Rosetta Predictions human pricing
NM_001008892 Rosetta Predictions human pricing
NM_001008894 Rosetta Predictions human pricing
NM_030922 Rosetta Predictions human pricing
NM_001107518 Rosetta Predictions rat pricing
NM_023647 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180317 predicted 1392
2 SASI_Hs01_00180318 predicted 1377
3 SASI_Hs01_00180319 predicted 960
4 SASI_Hs02_00305585 predicted 962
5 SASI_Hs01_00180320 predicted 1439
6 SASI_Hs01_00180321 predicted 1512
7 SASI_Hs01_00180322 predicted 1596
8 SASI_Hs01_00180323 predicted 1446
9 SASI_Hs01_00180325 predicted 1224
10 SASI_Hs01_00180326 predicted 1571
11 SASI_Hs01_00180324 predicted 1183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216863 predicted 1256
2 SASI_Hs01_00216864 predicted 1244
3 SASI_Hs01_00216865 predicted 827
4 SASI_Hs02_00305587 predicted 829
5 SASI_Hs01_00216866 predicted 1306
6 SASI_Hs01_00216867 predicted 1380
7 SASI_Hs01_00216868 predicted 1454
8 SASI_Hs01_00216869 predicted 1313
9 SASI_Hs01_00216871 predicted 1088
10 SASI_Hs01_00216872 predicted 1435
11 SASI_Hs01_00216870 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184166 predicted 1203
2 SASI_Hs01_00184167 predicted 1183
3 SASI_Hs01_00184168 predicted 762
4 SASI_Hs02_00305588 predicted 769
5 SASI_Hs01_00184169 predicted 1244
6 SASI_Hs01_00184170 predicted 1323
7 SASI_Hs01_00184171 predicted 1402
8 SASI_Hs01_00184172 predicted 1253
9 SASI_Hs01_00184174 predicted 1026
10 SASI_Hs01_00184175 predicted 1382
11 SASI_Hs01_00184173 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211778 predicted 1516
2 SASI_Hs01_00211779 predicted 1502
3 SASI_Hs01_00211780 predicted 1086
4 SASI_Hs02_00358473 predicted 1087
5 SASI_Hs01_00211781 predicted 1561
6 SASI_Hs01_00211782 predicted 1635
7 SASI_Hs01_00211783 predicted 1713
8 SASI_Hs01_00211784 predicted 1568
9 SASI_Hs01_00211786 predicted 1341
10 SASI_Hs01_00211787 predicted 1699
11 SASI_Hs01_00211785 predicted 1310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229615 predicted 779
2 SASI_Rn02_00229616 predicted 1367
3 SASI_Rn02_00229617 predicted 1005
4 SASI_Rn02_00229618 predicted 1445
5 SASI_Rn02_00229619 predicted 891
6 SASI_Rn02_00229620 predicted 1431
7 SASI_Rn02_00229621 predicted 830
8 SASI_Rn02_00229622 predicted 1286
9 SASI_Rn02_00229623 predicted 954
10 SASI_Rn02_00229624 predicted 1396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054976 predicted 1557
2 SASI_Mm01_00054978 predicted 2102
3 SASI_Mm01_00054980 predicted 1735
4 SASI_Mm02_00327259 predicted 1593
5 SASI_Mm01_00054981 predicted 2029
6 SASI_Mm01_00054982 predicted 1562
7 SASI_Mm01_00054983 predicted 2179
8 SASI_Mm01_00054984 predicted 2106
9 SASI_Mm01_00054985 predicted 1615
10 SASI_Mm02_00327260 predicted 1870
11 SASI_Mm01_00054977 predicted 1699
12 SASI_Mm01_00054979 predicted 2181
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030922
VALIDATED
NIPA2 MISSION shRNA Bacterial Glycerol Stock
non imprinted in Prader-Willi/Angelman syndrome 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030922.5-992s21c1
Sequence:CCGGGTCATTCATGCTCCAAAGGAACTCGAGTTCCTTTGGAGCATGAATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030922.5-1442s21c1
Sequence:CCGGGACGATGTCATTGGTACTTTGCTCGAGCAAAGTACCAATGACATCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1065s1c1
Sequence:CCGGCATTGCTATCAAGGAGCTGTTCTCGAGAACAGCTCCTTGATAGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1513s1c1
Sequence:CCGGGTCTCCCGAAGAAATGGAAATCTCGAGATTTCCATTTCTTCGGGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030922.3-844s1c1
Sequence:CCGGGTCATTCATGCTCCAAAGGAACTCGAGTTCCTTTGGAGCATGAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1357s1c1
Sequence:CCGGGCCTTTAAAGACGTCAGCTTTCTCGAGAAAGCTGACGTCTTTAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1523s1c1
Sequence:CCGGGAAATGGAAATCTGACAGCTTCTCGAGAAGCTGTCAGATTTCCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1341s1c1
Sequence:CCGGGATATTCTTGTTGCATGCCTTCTCGAGAAGGCATGCAACAAGAATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1414s1c1
Sequence:CCGGGAGAAAGCAATGAATGGCAATCTCGAGATTGCCATTCATTGCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030922.3-1413s1c1
Sequence:CCGGCGAGAAAGCAATGAATGGCAACTCGAGTTGCCATTCATTGCTTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030922.5-1883s21c1
Sequence:CCGGGACCTCAGCACATGACGATTTCTCGAGAAATCGTCATGTGCTGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030922.5-880s21c1
Sequence:CCGGAGCTCTCAGCGTGCTAGTAAGCTCGAGCTTACTAGCACGCTGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1069s1c1
Sequence:CCGGGCTATCAAGGAGCTGTTTGCACTCGAGTGCAAACAGCTCCTTGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1278s1c1
Sequence:CCGGGCAAGATATGCCTGTTGACGACTCGAGTCGTCAACAGGCATATCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030922.5-1561s21c1
Sequence:CCGGCGAGAAAGCAATGAATGGCAACTCGAGTTGCCATTCATTGCTTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030922
VALIDATED
NIPA2 MISSION shRNA shRNA Plasmid DNA
non imprinted in Prader-Willi/Angelman syndrome 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030922.5-992s21c1
Sequence:CCGGGTCATTCATGCTCCAAAGGAACTCGAGTTCCTTTGGAGCATGAATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030922.5-1442s21c1
Sequence:CCGGGACGATGTCATTGGTACTTTGCTCGAGCAAAGTACCAATGACATCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1065s1c1
Sequence:CCGGCATTGCTATCAAGGAGCTGTTCTCGAGAACAGCTCCTTGATAGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1513s1c1
Sequence:CCGGGTCTCCCGAAGAAATGGAAATCTCGAGATTTCCATTTCTTCGGGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030922.3-844s1c1
Sequence:CCGGGTCATTCATGCTCCAAAGGAACTCGAGTTCCTTTGGAGCATGAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1357s1c1
Sequence:CCGGGCCTTTAAAGACGTCAGCTTTCTCGAGAAAGCTGACGTCTTTAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1523s1c1
Sequence:CCGGGAAATGGAAATCTGACAGCTTCTCGAGAAGCTGTCAGATTTCCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1341s1c1
Sequence:CCGGGATATTCTTGTTGCATGCCTTCTCGAGAAGGCATGCAACAAGAATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1414s1c1
Sequence:CCGGGAGAAAGCAATGAATGGCAATCTCGAGATTGCCATTCATTGCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030922.3-1413s1c1
Sequence:CCGGCGAGAAAGCAATGAATGGCAACTCGAGTTGCCATTCATTGCTTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030922.5-1883s21c1
Sequence:CCGGGACCTCAGCACATGACGATTTCTCGAGAAATCGTCATGTGCTGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030922.5-880s21c1
Sequence:CCGGAGCTCTCAGCGTGCTAGTAAGCTCGAGCTTACTAGCACGCTGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1069s1c1
Sequence:CCGGGCTATCAAGGAGCTGTTTGCACTCGAGTGCAAACAGCTCCTTGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1278s1c1
Sequence:CCGGGCAAGATATGCCTGTTGACGACTCGAGTCGTCAACAGGCATATCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030922.5-1561s21c1
Sequence:CCGGCGAGAAAGCAATGAATGGCAACTCGAGTTGCCATTCATTGCTTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030922
VALIDATED
NIPA2 MISSION shRNA Lentiviral Transduction Particles
non imprinted in Prader-Willi/Angelman syndrome 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030922.5-992s21c1
Sequence:CCGGGTCATTCATGCTCCAAAGGAACTCGAGTTCCTTTGGAGCATGAATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030922.5-1442s21c1
Sequence:CCGGGACGATGTCATTGGTACTTTGCTCGAGCAAAGTACCAATGACATCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1065s1c1
Sequence:CCGGCATTGCTATCAAGGAGCTGTTCTCGAGAACAGCTCCTTGATAGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1513s1c1
Sequence:CCGGGTCTCCCGAAGAAATGGAAATCTCGAGATTTCCATTTCTTCGGGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030922.3-844s1c1
Sequence:CCGGGTCATTCATGCTCCAAAGGAACTCGAGTTCCTTTGGAGCATGAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1357s1c1
Sequence:CCGGGCCTTTAAAGACGTCAGCTTTCTCGAGAAAGCTGACGTCTTTAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1523s1c1
Sequence:CCGGGAAATGGAAATCTGACAGCTTCTCGAGAAGCTGTCAGATTTCCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1341s1c1
Sequence:CCGGGATATTCTTGTTGCATGCCTTCTCGAGAAGGCATGCAACAAGAATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1414s1c1
Sequence:CCGGGAGAAAGCAATGAATGGCAATCTCGAGATTGCCATTCATTGCTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030922.3-1413s1c1
Sequence:CCGGCGAGAAAGCAATGAATGGCAACTCGAGTTGCCATTCATTGCTTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030922.5-1883s21c1
Sequence:CCGGGACCTCAGCACATGACGATTTCTCGAGAAATCGTCATGTGCTGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030922.5-880s21c1
Sequence:CCGGAGCTCTCAGCGTGCTAGTAAGCTCGAGCTTACTAGCACGCTGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1069s1c1
Sequence:CCGGGCTATCAAGGAGCTGTTTGCACTCGAGTGCAAACAGCTCCTTGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030922.3-1278s1c1
Sequence:CCGGGCAAGATATGCCTGTTGACGACTCGAGTCGTCAACAGGCATATCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030922.5-1561s21c1
Sequence:CCGGCGAGAAAGCAATGAATGGCAACTCGAGTTGCCATTCATTGCTTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023647
VALIDATED
NIPA2 MISSION shRNA Bacterial Glycerol Stock
non imprinted in Prader-Willi/Angelman syndrome 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023647.5-1417s21c1
Sequence:CCGGAGCCGGTGAAGTGGCCAATTTCTCGAGAAATTGGCCACTTCACCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023647.5-1615s21c1
Sequence:CCGGAGAGGAGATTGAGACCTTAAACTCGAGTTTAAGGTCTCAATCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023647.5-2477s21c1
Sequence:CCGGACCTCAGTACATGGCTAATTTCTCGAGAAATTAGCCATGTACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023647.5-1667s21c1
Sequence:CCGGTTTGTGGTCTTTGCAACATTTCTCGAGAAATGTTGCAAAGACCACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023647.2-2177s1c1
Sequence:CCGGGAATGGCAATCTTTCTAGTATCTCGAGATACTAGAAAGATTGCCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023647.2-1740s1c1
Sequence:CCGGCAGACAAACATTCTTGTGTATCTCGAGATACACAAGAATGTTTGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023647.2-1906s1c1
Sequence:CCGGGCACACAGATTAATTACCTAACTCGAGTTAGGTAATTAATCTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023647.2-1366s1c1
Sequence:CCGGGCCATGCATATCTTAAGGAATCTCGAGATTCCTTAAGATATGCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023647.2-2375s1c1
Sequence:CCGGCCTCAAATAATGTCCTCTAAACTCGAGTTTAGAGGACATTATTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023647
VALIDATED
NIPA2 MISSION shRNA shRNA Plasmid DNA
non imprinted in Prader-Willi/Angelman syndrome 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023647.5-1417s21c1
Sequence:CCGGAGCCGGTGAAGTGGCCAATTTCTCGAGAAATTGGCCACTTCACCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023647.5-1615s21c1
Sequence:CCGGAGAGGAGATTGAGACCTTAAACTCGAGTTTAAGGTCTCAATCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023647.5-2477s21c1
Sequence:CCGGACCTCAGTACATGGCTAATTTCTCGAGAAATTAGCCATGTACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023647.5-1667s21c1
Sequence:CCGGTTTGTGGTCTTTGCAACATTTCTCGAGAAATGTTGCAAAGACCACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023647.2-2177s1c1
Sequence:CCGGGAATGGCAATCTTTCTAGTATCTCGAGATACTAGAAAGATTGCCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023647.2-1740s1c1
Sequence:CCGGCAGACAAACATTCTTGTGTATCTCGAGATACACAAGAATGTTTGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023647.2-1906s1c1
Sequence:CCGGGCACACAGATTAATTACCTAACTCGAGTTAGGTAATTAATCTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023647.2-1366s1c1
Sequence:CCGGGCCATGCATATCTTAAGGAATCTCGAGATTCCTTAAGATATGCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023647.2-2375s1c1
Sequence:CCGGCCTCAAATAATGTCCTCTAAACTCGAGTTTAGAGGACATTATTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023647
VALIDATED
NIPA2 MISSION shRNA Lentiviral Transduction Particles
non imprinted in Prader-Willi/Angelman syndrome 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023647.5-1417s21c1
Sequence:CCGGAGCCGGTGAAGTGGCCAATTTCTCGAGAAATTGGCCACTTCACCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023647.5-1615s21c1
Sequence:CCGGAGAGGAGATTGAGACCTTAAACTCGAGTTTAAGGTCTCAATCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023647.5-2477s21c1
Sequence:CCGGACCTCAGTACATGGCTAATTTCTCGAGAAATTAGCCATGTACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023647.5-1667s21c1
Sequence:CCGGTTTGTGGTCTTTGCAACATTTCTCGAGAAATGTTGCAAAGACCACAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023647.2-2177s1c1
Sequence:CCGGGAATGGCAATCTTTCTAGTATCTCGAGATACTAGAAAGATTGCCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023647.2-1740s1c1
Sequence:CCGGCAGACAAACATTCTTGTGTATCTCGAGATACACAAGAATGTTTGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023647.2-1906s1c1
Sequence:CCGGGCACACAGATTAATTACCTAACTCGAGTTAGGTAATTAATCTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023647.2-1366s1c1
Sequence:CCGGGCCATGCATATCTTAAGGAATCTCGAGATTCCTTAAGATATGCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023647.2-2375s1c1
Sequence:CCGGCCTCAAATAATGTCCTCTAAACTCGAGTTTAGAGGACATTATTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)