EMAIL THIS PAGE TO A FRIEND

NIPAL1

NIPA-like domain containing 1

70 Gene Product Result for
Synonyms: NPAL1
UniProtKB ID: Q6NVV3, B3KTB0, Q68DA9
Gene ID:
Mouse(70701) NIPA-like domain containing 1
Rat(289594) NIPA-like domain containing 1
chicken(428783) NIPA-like domain containing 1
dog(482138) NIPA-like domain containing 1
domestic cat(101089608) NIPA-like domain containing 1
cow(539757) NIPA-like domain containing 1
sheep(101101985) NIPA-like domain containing 1
naked mole-rat(101714167) NIPA-like domain containing 1
domestic guinea pig(100721159) NIPA-like domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081205 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081205 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081205 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207330 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207330 Rosetta Predictions human pricing
NM_001106003 Rosetta Predictions rat pricing
NM_001081205 Rosetta Predictions mouse pricing
XM_355676 Rosetta Predictions mouse pricing
XM_994206 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143381 predicted 261
2 SASI_Hs01_00143383 predicted 217
3 SASI_Hs01_00143384 predicted 755
4 SASI_Hs01_00143385 predicted 643
5 SASI_Hs01_00143386 predicted 1086
6 SASI_Hs01_00143387 predicted 1163
7 SASI_Hs01_00143388 predicted 1297
8 SASI_Hs01_00143389 predicted 1272
9 SASI_Hs02_00373876 predicted 552
10 SASI_Hs02_00373877 predicted 1315
11 SASI_Hs01_00143380 predicted 906
12 SASI_Hs01_00143382 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214672 predicted 870
2 SASI_Rn02_00214673 predicted 247
3 SASI_Rn02_00214674 predicted 276
4 SASI_Rn02_00214675 predicted 714
5 SASI_Rn02_00214676 predicted 507
6 SASI_Rn02_00214677 predicted 864
7 SASI_Rn02_00214678 predicted 405
8 SASI_Rn02_00214679 predicted 868
9 SASI_Rn02_00214680 predicted 735
10 SASI_Rn02_00214681 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081205 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296221 predicted 817
2 SASI_Mm02_00296222 predicted 548
3 SASI_Mm02_00296223 predicted 291
4 SASI_Mm02_00296224 predicted 1214
5 SASI_Mm02_00296225 predicted 770
6 SASI_Mm02_00296226 predicted 785
7 SASI_Mm02_00296227 predicted 1093
8 SASI_Mm02_00296228 predicted 536
9 SASI_Mm02_00296229 predicted 1190
10 SASI_Mm02_00296230 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211667 predicted 819
2 SASI_Mm01_00211668 predicted 556
3 SASI_Mm01_00211669 predicted 289
4 SASI_Mm01_00211670 predicted 1217
5 SASI_Mm01_00211671 predicted 783
6 SASI_Mm01_00211672 predicted 787
7 SASI_Mm01_00211673 predicted 1099
8 SASI_Mm01_00211674 predicted 551
9 SASI_Mm01_00211675 predicted 1194
10 SASI_Mm01_00211676 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275041 predicted 739
2 SASI_Mm01_00275042 predicted 470
3 SASI_Mm01_00275043 predicted 274
4 SASI_Mm01_00275044 predicted 1147
5 SASI_Mm01_00275045 predicted 705
6 SASI_Mm01_00275046 predicted 710
7 SASI_Mm01_00275047 predicted 1016
8 SASI_Mm01_00275048 predicted 466
9 SASI_Mm01_00275049 predicted 1110
10 SASI_Mm01_00275050 predicted 975
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081205
NIPAL1 MISSION shRNA Bacterial Glycerol Stock
NIPA-like domain containing 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081205.1-1318s21c1
Sequence:CCGGATGACCAAAGTAGCCATAAACCTCGAGGTTTATGGCTACTTTGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081205.1-630s21c1
Sequence:CCGGGGGTCAACTGTGATGGTTATCCTCGAGGATAACCATCACAGTTGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081205.1-779s21c1
Sequence:CCGGCAAGAAAGGACAGACTAATATCTCGAGATATTAGTCTGTCCTTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081205.1-948s21c1
Sequence:CCGGTCCGTGACCACCCAGATTAACCTCGAGGTTAATCTGGGTGGTCACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081205
NIPAL1 MISSION shRNA shRNA Plasmid DNA
NIPA-like domain containing 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081205.1-1318s21c1
Sequence:CCGGATGACCAAAGTAGCCATAAACCTCGAGGTTTATGGCTACTTTGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081205.1-630s21c1
Sequence:CCGGGGGTCAACTGTGATGGTTATCCTCGAGGATAACCATCACAGTTGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081205.1-779s21c1
Sequence:CCGGCAAGAAAGGACAGACTAATATCTCGAGATATTAGTCTGTCCTTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081205.1-948s21c1
Sequence:CCGGTCCGTGACCACCCAGATTAACCTCGAGGTTAATCTGGGTGGTCACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081205
NIPAL1 MISSION shRNA Lentiviral Transduction Particles
NIPA-like domain containing 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081205.1-1318s21c1
Sequence:CCGGATGACCAAAGTAGCCATAAACCTCGAGGTTTATGGCTACTTTGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081205.1-630s21c1
Sequence:CCGGGGGTCAACTGTGATGGTTATCCTCGAGGATAACCATCACAGTTGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081205.1-779s21c1
Sequence:CCGGCAAGAAAGGACAGACTAATATCTCGAGATATTAGTCTGTCCTTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081205.1-948s21c1
Sequence:CCGGTCCGTGACCACCCAGATTAACCTCGAGGTTAATCTGGGTGGTCACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207330
NIPAL1 MISSION shRNA Bacterial Glycerol Stock
NIPA-like domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207330.1-1535s1c1
Sequence:CCGGGCTATGTGTGTCTCAGAATAACTCGAGTTATTCTGAGACACACATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207330.1-219s1c1
Sequence:CCGGCAGCATAAACAACTTGAGCATCTCGAGATGCTCAAGTTGTTTATGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207330.1-1252s1c1
Sequence:CCGGCCAGGATACAATGATGACGTTCTCGAGAACGTCATCATTGTATCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207330.1-1085s1c1
Sequence:CCGGCCCTGAGTGGATTCTTCACTACTCGAGTAGTGAAGAATCCACTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207330.1-974s1c1
Sequence:CCGGCCTCTCTTGTGACACCCATTTCTCGAGAAATGGGTGTCACAAGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207330.1-855s1c1
Sequence:CCGGGCTGATAGAATGGAAGCCAGTCTCGAGACTGGCTTCCATTCTATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207330.1-792s1c1
Sequence:CCGGCTGTTCCTTGATTGGAGCGTTCTCGAGAACGCTCCAATCAAGGAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207330.1-1101s1c1
Sequence:CCGGCACTATTATCATTGGCATCTTCTCGAGAAGATGCCAATGATAATAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122077    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207330.1-1512s1c1
Sequence:CCGGCTAAGGATCAAAGAAGTCAAACTCGAGTTTGACTTCTTTGATCCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207330
NIPAL1 MISSION shRNA shRNA Plasmid DNA
NIPA-like domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207330.1-1535s1c1
Sequence:CCGGGCTATGTGTGTCTCAGAATAACTCGAGTTATTCTGAGACACACATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207330.1-219s1c1
Sequence:CCGGCAGCATAAACAACTTGAGCATCTCGAGATGCTCAAGTTGTTTATGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207330.1-1252s1c1
Sequence:CCGGCCAGGATACAATGATGACGTTCTCGAGAACGTCATCATTGTATCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207330.1-1085s1c1
Sequence:CCGGCCCTGAGTGGATTCTTCACTACTCGAGTAGTGAAGAATCCACTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207330.1-974s1c1
Sequence:CCGGCCTCTCTTGTGACACCCATTTCTCGAGAAATGGGTGTCACAAGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207330.1-855s1c1
Sequence:CCGGGCTGATAGAATGGAAGCCAGTCTCGAGACTGGCTTCCATTCTATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207330.1-792s1c1
Sequence:CCGGCTGTTCCTTGATTGGAGCGTTCTCGAGAACGCTCCAATCAAGGAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207330.1-1101s1c1
Sequence:CCGGCACTATTATCATTGGCATCTTCTCGAGAAGATGCCAATGATAATAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122077    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207330.1-1512s1c1
Sequence:CCGGCTAAGGATCAAAGAAGTCAAACTCGAGTTTGACTTCTTTGATCCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207330
NIPAL1 MISSION shRNA Lentiviral Transduction Particles
NIPA-like domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207330.1-1535s1c1
Sequence:CCGGGCTATGTGTGTCTCAGAATAACTCGAGTTATTCTGAGACACACATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207330.1-219s1c1
Sequence:CCGGCAGCATAAACAACTTGAGCATCTCGAGATGCTCAAGTTGTTTATGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207330.1-1252s1c1
Sequence:CCGGCCAGGATACAATGATGACGTTCTCGAGAACGTCATCATTGTATCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207330.1-1085s1c1
Sequence:CCGGCCCTGAGTGGATTCTTCACTACTCGAGTAGTGAAGAATCCACTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207330.1-974s1c1
Sequence:CCGGCCTCTCTTGTGACACCCATTTCTCGAGAAATGGGTGTCACAAGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207330.1-855s1c1
Sequence:CCGGGCTGATAGAATGGAAGCCAGTCTCGAGACTGGCTTCCATTCTATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207330.1-792s1c1
Sequence:CCGGCTGTTCCTTGATTGGAGCGTTCTCGAGAACGCTCCAATCAAGGAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207330.1-1101s1c1
Sequence:CCGGCACTATTATCATTGGCATCTTCTCGAGAAGATGCCAATGATAATAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122077    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207330.1-1512s1c1
Sequence:CCGGCTAAGGATCAAAGAAGTCAAACTCGAGTTTGACTTCTTTGATCCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)