EMAIL THIS PAGE TO A FRIEND

NIPAL2

NIPA-like domain containing 2

88 Gene Product Result for
Synonyms: NPAL2
UniProtKB ID: Q9H841
Gene ID:
Mouse(223473) NIPA-like domain containing 2
Rat(362899) NIPA-like domain containing 2
domestic guinea pig(100713436) NIPA-like domain containing 2
naked mole-rat(101714393) NIPA-like domain containing 2
sheep(101106339) NIPA-like domain containing 2
chicken(771428) NIPA-like domain containing 2
domestic cat(101095714) NIPA-like domain containing 2
cow(781492) NIPA-like domain containing 2
dog(606846) NIPA-like domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024759 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024759 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024759 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024759 Rosetta Predictions human pricing
NM_001130559 Rosetta Predictions rat pricing
NM_145469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128201 predicted 1121
2 SASI_Hs01_00128202 predicted 863
3 SASI_Hs01_00128203 predicted 760
4 SASI_Hs01_00128204 predicted 861
5 SASI_Hs01_00128205 predicted 901
6 SASI_Hs01_00128206 predicted 1460
7 SASI_Hs02_00357261 predicted 1308
8 SASI_Hs01_00128208 predicted 1123
9 SASI_Hs01_00128209 predicted 694
10 SASI_Hs01_00128210 predicted 1250
11 SASI_Hs01_00128207 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255759 predicted 1744
2 SASI_Rn02_00255760 predicted 872
3 SASI_Rn02_00255761 predicted 1152
4 SASI_Rn02_00255762 predicted 670
5 SASI_Rn02_00255763 predicted 1362
6 SASI_Rn02_00255764 predicted 1219
7 SASI_Rn02_00255765 predicted 1699
8 SASI_Rn02_00255766 predicted 1563
9 SASI_Rn02_00255767 predicted 786
10 SASI_Rn02_00255768 predicted 1489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044973 predicted 1065
2 SASI_Mm01_00044974 predicted 664
3 SASI_Mm01_00044975 predicted 736
4 SASI_Mm01_00044976 predicted 520
5 SASI_Mm01_00044977 predicted 1073
6 SASI_Mm01_00044978 predicted 874
7 SASI_Mm01_00044979 predicted 1250
8 SASI_Mm02_00340865 predicted 373
9 SASI_Mm01_00044980 predicted 544
10 SASI_Mm01_00044981 predicted 1187
11 SASI_Mm01_00044982 predicted 448
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024759
VALIDATED
NIPAL2 MISSION shRNA Bacterial Glycerol Stock
NIPA-like domain containing 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024759.1-796s1c1
Sequence:CCGGGCAGTTCCTGATCTATGTGATCTCGAGATCACATAGATCAGGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024759.1-633s1c1
Sequence:CCGGGTAGTGCCATTATTTCTGTTACTCGAGTAACAGAAATAATGGCACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024759.1-762s1c1
Sequence:CCGGCAGCAAGAACAGTACAGTATTCTCGAGAATACTGTACTGTTCTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024759.1-1065s1c1
Sequence:CCGGCGAAACTCTACAATACGACAACTCGAGTTGTCGTATTGTAGAGTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024759.1-1417s1c1
Sequence:CCGGGAGAGAAGAAAGAGGTCTAAACTCGAGTTTAGACCTCTTTCTTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024759.1-1349s21c1
Sequence:CCGGACCAGATTCACATAGCTTATCCTCGAGGATAAGCTATGTGAATCTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024759.1-1127s21c1
Sequence:CCGGATCATTGCAGGTATCATATTTCTCGAGAAATATGATACCTGCAATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024759.1-426s21c1
Sequence:CCGGGAAACTTGGTGATCAGTATTTCTCGAGAAATACTGATCACCAAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024759.1-910s21c1
Sequence:CCGGAGCCTCATTGACTGTTATTTCCTCGAGGAAATAACAGTCAATGAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024759.1-703s21c1
Sequence:CCGGGGCATTTGCAGGAACATATTTCTCGAGAAATATGTTCCTGCAAATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024759.1-1600s21c1
Sequence:CCGGAGCTCTGACAGTCTAATATTTCTCGAGAAATATTAGACTGTCAGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024759
VALIDATED
NIPAL2 MISSION shRNA shRNA Plasmid DNA
NIPA-like domain containing 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024759.1-796s1c1
Sequence:CCGGGCAGTTCCTGATCTATGTGATCTCGAGATCACATAGATCAGGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024759.1-633s1c1
Sequence:CCGGGTAGTGCCATTATTTCTGTTACTCGAGTAACAGAAATAATGGCACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024759.1-762s1c1
Sequence:CCGGCAGCAAGAACAGTACAGTATTCTCGAGAATACTGTACTGTTCTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024759.1-1065s1c1
Sequence:CCGGCGAAACTCTACAATACGACAACTCGAGTTGTCGTATTGTAGAGTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024759.1-1417s1c1
Sequence:CCGGGAGAGAAGAAAGAGGTCTAAACTCGAGTTTAGACCTCTTTCTTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024759.1-1349s21c1
Sequence:CCGGACCAGATTCACATAGCTTATCCTCGAGGATAAGCTATGTGAATCTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024759.1-1127s21c1
Sequence:CCGGATCATTGCAGGTATCATATTTCTCGAGAAATATGATACCTGCAATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024759.1-426s21c1
Sequence:CCGGGAAACTTGGTGATCAGTATTTCTCGAGAAATACTGATCACCAAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024759.1-910s21c1
Sequence:CCGGAGCCTCATTGACTGTTATTTCCTCGAGGAAATAACAGTCAATGAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024759.1-703s21c1
Sequence:CCGGGGCATTTGCAGGAACATATTTCTCGAGAAATATGTTCCTGCAAATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024759.1-1600s21c1
Sequence:CCGGAGCTCTGACAGTCTAATATTTCTCGAGAAATATTAGACTGTCAGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024759
VALIDATED
NIPAL2 MISSION shRNA Lentiviral Transduction Particles
NIPA-like domain containing 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024759.1-796s1c1
Sequence:CCGGGCAGTTCCTGATCTATGTGATCTCGAGATCACATAGATCAGGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024759.1-633s1c1
Sequence:CCGGGTAGTGCCATTATTTCTGTTACTCGAGTAACAGAAATAATGGCACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024759.1-762s1c1
Sequence:CCGGCAGCAAGAACAGTACAGTATTCTCGAGAATACTGTACTGTTCTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024759.1-1065s1c1
Sequence:CCGGCGAAACTCTACAATACGACAACTCGAGTTGTCGTATTGTAGAGTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024759.1-1417s1c1
Sequence:CCGGGAGAGAAGAAAGAGGTCTAAACTCGAGTTTAGACCTCTTTCTTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024759.1-1349s21c1
Sequence:CCGGACCAGATTCACATAGCTTATCCTCGAGGATAAGCTATGTGAATCTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024759.1-1127s21c1
Sequence:CCGGATCATTGCAGGTATCATATTTCTCGAGAAATATGATACCTGCAATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024759.1-426s21c1
Sequence:CCGGGAAACTTGGTGATCAGTATTTCTCGAGAAATACTGATCACCAAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024759.1-910s21c1
Sequence:CCGGAGCCTCATTGACTGTTATTTCCTCGAGGAAATAACAGTCAATGAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024759.1-703s21c1
Sequence:CCGGGGCATTTGCAGGAACATATTTCTCGAGAAATATGTTCCTGCAAATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024759.1-1600s21c1
Sequence:CCGGAGCTCTGACAGTCTAATATTTCTCGAGAAATATTAGACTGTCAGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145469
VALIDATED
NIPAL2 MISSION shRNA Bacterial Glycerol Stock
NIPA-like domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145469.2-1590s1c1
Sequence:CCGGGCCTTCTATGAACCTCTCTTACTCGAGTAAGAGAGGTTCATAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145469.2-737s1c1
Sequence:CCGGGCAGCTAACTTATGCCATCTTCTCGAGAAGATGGCATAAGTTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145469.2-138s1c1
Sequence:CCGGCGCAGAAACCAGATTCACCTTCTCGAGAAGGTGAATCTGGTTTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145469.2-555s1c1
Sequence:CCGGCAATTCCTGGTCTATGTGATTCTCGAGAATCACATAGACCAGGAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145469.2-251s1c1
Sequence:CCGGGCACCCAAAGCCATACTTTAACTCGAGTTAAAGTATGGCTTTGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145469.5-882s21c1
Sequence:CCGGCCATCATCGCAGGCATCATATCTCGAGATATGATGCCTGCGATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145469.5-384s21c1
Sequence:CCGGTTACAGGTAGTGCCATAATTTCTCGAGAAATTATGGCACTACCTGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145469.5-1538s21c1
Sequence:CCGGACACTACAACCTTAGTCTTTACTCGAGTAAAGACTAAGGTTGTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145469.5-249s21c1
Sequence:CCGGAGCACCCAAAGCCATACTTTACTCGAGTAAAGTATGGCTTTGGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145469.5-426s21c1
Sequence:CCGGATTTGAGAGCCTCGGATTTACCTCGAGGTAAATCCGAGGCTCTCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145469
VALIDATED
NIPAL2 MISSION shRNA shRNA Plasmid DNA
NIPA-like domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145469.2-1590s1c1
Sequence:CCGGGCCTTCTATGAACCTCTCTTACTCGAGTAAGAGAGGTTCATAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145469.2-737s1c1
Sequence:CCGGGCAGCTAACTTATGCCATCTTCTCGAGAAGATGGCATAAGTTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145469.2-138s1c1
Sequence:CCGGCGCAGAAACCAGATTCACCTTCTCGAGAAGGTGAATCTGGTTTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145469.2-555s1c1
Sequence:CCGGCAATTCCTGGTCTATGTGATTCTCGAGAATCACATAGACCAGGAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145469.2-251s1c1
Sequence:CCGGGCACCCAAAGCCATACTTTAACTCGAGTTAAAGTATGGCTTTGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145469.5-882s21c1
Sequence:CCGGCCATCATCGCAGGCATCATATCTCGAGATATGATGCCTGCGATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145469.5-384s21c1
Sequence:CCGGTTACAGGTAGTGCCATAATTTCTCGAGAAATTATGGCACTACCTGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145469.5-1538s21c1
Sequence:CCGGACACTACAACCTTAGTCTTTACTCGAGTAAAGACTAAGGTTGTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145469.5-249s21c1
Sequence:CCGGAGCACCCAAAGCCATACTTTACTCGAGTAAAGTATGGCTTTGGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145469.5-426s21c1
Sequence:CCGGATTTGAGAGCCTCGGATTTACCTCGAGGTAAATCCGAGGCTCTCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145469
VALIDATED
NIPAL2 MISSION shRNA Lentiviral Transduction Particles
NIPA-like domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145469.2-1590s1c1
Sequence:CCGGGCCTTCTATGAACCTCTCTTACTCGAGTAAGAGAGGTTCATAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145469.2-737s1c1
Sequence:CCGGGCAGCTAACTTATGCCATCTTCTCGAGAAGATGGCATAAGTTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145469.2-138s1c1
Sequence:CCGGCGCAGAAACCAGATTCACCTTCTCGAGAAGGTGAATCTGGTTTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145469.2-555s1c1
Sequence:CCGGCAATTCCTGGTCTATGTGATTCTCGAGAATCACATAGACCAGGAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145469.2-251s1c1
Sequence:CCGGGCACCCAAAGCCATACTTTAACTCGAGTTAAAGTATGGCTTTGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145469.5-882s21c1
Sequence:CCGGCCATCATCGCAGGCATCATATCTCGAGATATGATGCCTGCGATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145469.5-384s21c1
Sequence:CCGGTTACAGGTAGTGCCATAATTTCTCGAGAAATTATGGCACTACCTGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145469.5-1538s21c1
Sequence:CCGGACACTACAACCTTAGTCTTTACTCGAGTAAAGACTAAGGTTGTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145469.5-249s21c1
Sequence:CCGGAGCACCCAAAGCCATACTTTACTCGAGTAAAGTATGGCTTTGGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145469.5-426s21c1
Sequence:CCGGATTTGAGAGCCTCGGATTTACCTCGAGGTAAATCCGAGGCTCTCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)