EMAIL THIS PAGE TO A FRIEND

NIPAL3

NIPA-like domain containing 3

68 Gene Product Result for
Synonyms: DJ462O23.2 NPAL3
UniProtKB ID: Q6P499, A2A298, Q6MZT9, Q9BVE6
Gene ID:
Mouse(74552) NIPA-like domain containing 3
Rat(502990) NIPA-like domain containing 3
Zebrafish(436907) NIPA-like domain containing 3
chicken(419697) NIPA-like domain containing 3
cow(616724) NIPA-like domain containing 3
Horse(100071495) NIPA-like domain containing 3
domestic cat(101097993) NIPA-like domain containing 3
dog(487370) NIPA-like domain containing 3
sheep(101117397) NIPA-like domain containing 3
naked mole-rat(101722890) NIPA-like domain containing 3
Domestic Rabbit(100355878) NIPA-like domain containing 3
domestic guinea pig(100719879) NIPA-like domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020448 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028995 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028995 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028995 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020448 Rosetta Predictions human pricing
XM_578498 Rosetta Predictions rat pricing
NM_028995 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170639 predicted 1183
2 SASI_Hs01_00170640 predicted 813
3 SASI_Hs01_00170641 predicted 1602
4 SASI_Hs01_00170642 predicted 915
5 SASI_Hs02_00353484 predicted 700
6 SASI_Hs01_00170645 predicted 928
7 SASI_Hs01_00170646 predicted 540
8 SASI_Hs02_00353485 predicted 784
9 SASI_Hs01_00170648 predicted 1436
10 SASI_Hs02_00353486 predicted 676
11 SASI_Hs01_00170643 predicted 658
12 SASI_Hs01_00170644 predicted 1651
13 SASI_Hs01_00170647 predicted 1664
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407997 predicted 475
2 SASI_Rn02_00407998 predicted 406
3 SASI_Rn02_00407999 predicted 445
4 SASI_Rn02_00408000 predicted 293
5 SASI_Rn02_00408001 predicted 277
6 SASI_Rn02_00408002 predicted 458
7 SASI_Rn02_00408003 predicted 320
8 SASI_Rn02_00408004 predicted 464
9 SASI_Rn02_00408005 predicted 348
10 SASI_Rn02_00408006 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028995 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085411 predicted 672
2 SASI_Mm01_00085412 predicted 676
3 SASI_Mm01_00085413 predicted 713
4 SASI_Mm01_00085414 predicted 1087
5 SASI_Mm01_00085415 predicted 1538
6 SASI_Mm02_00334724 predicted 1298
7 SASI_Mm01_00085417 predicted 1618
8 SASI_Mm01_00085418 predicted 1588
9 SASI_Mm01_00085419 predicted 1611
10 SASI_Mm01_00085420 predicted 781
11 SASI_Mm01_00085416 predicted 782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020448
NIPAL3 MISSION shRNA Bacterial Glycerol Stock
NIPA-like domain containing 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020448.4-1674s21c1
Sequence:CCGGGGTTCAACCCTGAATCCTAAACTCGAGTTTAGGATTCAGGGTTGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020448.4-1432s21c1
Sequence:CCGGTGCAGAACATGCACGATAAAGCTCGAGCTTTATCGTGCATGTTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020448.2-718s1c1
Sequence:CCGGGAAAGACTTTCTGAGGCGCTACTCGAGTAGCGCCTCAGAAAGTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020448.2-734s1c1
Sequence:CCGGCGCTACGTCTTGTCCTTTGTTCTCGAGAACAAAGGACAAGACGTAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020448.2-481s1c1
Sequence:CCGGCATTGCACTTAACCTCCAGAACTCGAGTTCTGGAGGTTAAGTGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020448.2-1270s1c1
Sequence:CCGGCATTGCATTCTTGGGCGTCTTCTCGAGAAGACGCCCAAGAATGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020448.2-4703s1c1
Sequence:CCGGCCAATCTTTGTCCAGTGGTATCTCGAGATACCACTGGACAAAGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167109    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020448.2-3068s1c1
Sequence:CCGGCCAGTGTGATAGATCACTTATCTCGAGATAAGTGATCTATCACACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020448
NIPAL3 MISSION shRNA shRNA Plasmid DNA
NIPA-like domain containing 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020448.4-1674s21c1
Sequence:CCGGGGTTCAACCCTGAATCCTAAACTCGAGTTTAGGATTCAGGGTTGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020448.4-1432s21c1
Sequence:CCGGTGCAGAACATGCACGATAAAGCTCGAGCTTTATCGTGCATGTTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020448.2-718s1c1
Sequence:CCGGGAAAGACTTTCTGAGGCGCTACTCGAGTAGCGCCTCAGAAAGTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020448.2-734s1c1
Sequence:CCGGCGCTACGTCTTGTCCTTTGTTCTCGAGAACAAAGGACAAGACGTAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020448.2-481s1c1
Sequence:CCGGCATTGCACTTAACCTCCAGAACTCGAGTTCTGGAGGTTAAGTGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020448.2-1270s1c1
Sequence:CCGGCATTGCATTCTTGGGCGTCTTCTCGAGAAGACGCCCAAGAATGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020448.2-4703s1c1
Sequence:CCGGCCAATCTTTGTCCAGTGGTATCTCGAGATACCACTGGACAAAGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167109    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020448.2-3068s1c1
Sequence:CCGGCCAGTGTGATAGATCACTTATCTCGAGATAAGTGATCTATCACACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020448
NIPAL3 MISSION shRNA Lentiviral Transduction Particles
NIPA-like domain containing 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020448.4-1674s21c1
Sequence:CCGGGGTTCAACCCTGAATCCTAAACTCGAGTTTAGGATTCAGGGTTGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020448.4-1432s21c1
Sequence:CCGGTGCAGAACATGCACGATAAAGCTCGAGCTTTATCGTGCATGTTCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020448.2-718s1c1
Sequence:CCGGGAAAGACTTTCTGAGGCGCTACTCGAGTAGCGCCTCAGAAAGTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020448.2-734s1c1
Sequence:CCGGCGCTACGTCTTGTCCTTTGTTCTCGAGAACAAAGGACAAGACGTAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020448.2-481s1c1
Sequence:CCGGCATTGCACTTAACCTCCAGAACTCGAGTTCTGGAGGTTAAGTGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020448.2-1270s1c1
Sequence:CCGGCATTGCATTCTTGGGCGTCTTCTCGAGAAGACGCCCAAGAATGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020448.2-4703s1c1
Sequence:CCGGCCAATCTTTGTCCAGTGGTATCTCGAGATACCACTGGACAAAGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167109    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020448.2-3068s1c1
Sequence:CCGGCCAGTGTGATAGATCACTTATCTCGAGATAAGTGATCTATCACACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028995
NIPAL3 MISSION shRNA Bacterial Glycerol Stock
NIPA-like domain containing 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028995.3-1314s21c1
Sequence:CCGGATTCCGTTCGAGCCCTATATTCTCGAGAATATAGGGCTCGAACGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028995.3-436s21c1
Sequence:CCGGTCGGAGCACTCTTGGCCATTTCTCGAGAAATGGCCAAGAGTGCTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028995.3-2260s21c1
Sequence:CCGGCACTCTGTTTCCGGCTAATTACTCGAGTAATTAGCCGGAAACAGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028995.3-670s21c1
Sequence:CCGGGCGCCATCATCGGAATCATATCTCGAGATATGATTCCGATGATGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028995.3-1114s21c1
Sequence:CCGGGTGAAGCCTCCCAGATCTATGCTCGAGCATAGATCTGGGAGGCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028995.1-847s1c1
Sequence:CCGGGAAGATGACAGGCGAGAACATCTCGAGATGTTCTCGCCTGTCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028995.1-573s1c1
Sequence:CCGGCCTACTTCAAGACCAAGACATCTCGAGATGTCTTGGTCTTGAAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028995.1-817s1c1
Sequence:CCGGGCTAGTGACATTTGCACCCAACTCGAGTTGGGTGCAAATGTCACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028995
NIPAL3 MISSION shRNA shRNA Plasmid DNA
NIPA-like domain containing 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028995.3-1314s21c1
Sequence:CCGGATTCCGTTCGAGCCCTATATTCTCGAGAATATAGGGCTCGAACGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028995.3-436s21c1
Sequence:CCGGTCGGAGCACTCTTGGCCATTTCTCGAGAAATGGCCAAGAGTGCTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028995.3-2260s21c1
Sequence:CCGGCACTCTGTTTCCGGCTAATTACTCGAGTAATTAGCCGGAAACAGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028995.3-670s21c1
Sequence:CCGGGCGCCATCATCGGAATCATATCTCGAGATATGATTCCGATGATGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028995.3-1114s21c1
Sequence:CCGGGTGAAGCCTCCCAGATCTATGCTCGAGCATAGATCTGGGAGGCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028995.1-847s1c1
Sequence:CCGGGAAGATGACAGGCGAGAACATCTCGAGATGTTCTCGCCTGTCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028995.1-573s1c1
Sequence:CCGGCCTACTTCAAGACCAAGACATCTCGAGATGTCTTGGTCTTGAAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028995.1-817s1c1
Sequence:CCGGGCTAGTGACATTTGCACCCAACTCGAGTTGGGTGCAAATGTCACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028995
NIPAL3 MISSION shRNA Lentiviral Transduction Particles
NIPA-like domain containing 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028995.3-1314s21c1
Sequence:CCGGATTCCGTTCGAGCCCTATATTCTCGAGAATATAGGGCTCGAACGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028995.3-436s21c1
Sequence:CCGGTCGGAGCACTCTTGGCCATTTCTCGAGAAATGGCCAAGAGTGCTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028995.3-2260s21c1
Sequence:CCGGCACTCTGTTTCCGGCTAATTACTCGAGTAATTAGCCGGAAACAGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028995.3-670s21c1
Sequence:CCGGGCGCCATCATCGGAATCATATCTCGAGATATGATTCCGATGATGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028995.3-1114s21c1
Sequence:CCGGGTGAAGCCTCCCAGATCTATGCTCGAGCATAGATCTGGGAGGCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028995.1-847s1c1
Sequence:CCGGGAAGATGACAGGCGAGAACATCTCGAGATGTTCTCGCCTGTCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028995.1-573s1c1
Sequence:CCGGCCTACTTCAAGACCAAGACATCTCGAGATGTCTTGGTCTTGAAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028995.1-817s1c1
Sequence:CCGGGCTAGTGACATTTGCACCCAACTCGAGTTGGGTGCAAATGTCACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)