EMAIL THIS PAGE TO A FRIEND

NIPAL4

NIPA-like domain containing 4

71 Gene Product Result for
Synonyms: ARCI6 ICHTHYIN ICHYN
Gene ID:
Human(348938) Summary: This gene likely encodes a membrane receptor. Mutations in this gene have been associated with autosomal recessive congenital ichthyosis. [provided by RefSeq, Feb 2010]
Mouse(214112) NIPA-like domain containing 4
Rat(303070) NIPA-like domain containing 4
domestic guinea pig(100730933) NIPA-like domain containing 4
naked mole-rat(101707267) NIPA-like domain containing 4
sheep(101113410) NIPA-like domain containing 4
chicken(416245) NIPA-like domain containing 4
dog(489157) NIPA-like domain containing 4
domestic cat(101090487) NIPA-like domain containing 4
cow(532275) NIPA-like domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172524 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172524 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172524 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001099287 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099287 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099287 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099287 Rosetta Predictions human pricing
XM_371777 Rosetta Predictions human pricing
NM_001106995 Rosetta Predictions rat pricing
NM_172524 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320429 predicted 1309
2 SASI_Hs02_00320430 predicted 1415
3 SASI_Hs02_00320431 predicted 880
4 SASI_Hs02_00320432 predicted 1408
5 SASI_Hs02_00320433 predicted 1210
6 SASI_Hs02_00320434 predicted 1343
7 SASI_Hs02_00320435 predicted 419
8 SASI_Hs02_00320436 predicted 1298
9 SASI_Hs02_00320437 predicted 735
10 SASI_Hs02_00320438 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265326 predicted 1296
2 SASI_Hs01_00265327 predicted 878
3 SASI_Hs01_00265328 predicted 1400
4 SASI_Hs01_00265329 predicted 1197
5 SASI_Hs01_00265330 predicted 1330
6 SASI_Hs01_00265331 predicted 408
7 SASI_Hs01_00265332 predicted 1290
8 SASI_Hs01_00265333 predicted 727
9 SASI_Hs01_00265334 predicted 1470
10 SASI_Hs01_00265335 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224446 predicted 1708
2 SASI_Rn02_00224447 predicted 929
3 SASI_Rn02_00224448 predicted 667
4 SASI_Rn02_00224449 predicted 1640
5 SASI_Rn02_00224450 predicted 377
6 SASI_Rn02_00224451 predicted 449
7 SASI_Rn02_00224452 predicted 743
8 SASI_Rn02_00224453 predicted 1121
9 SASI_Rn02_00224454 predicted 1653
10 SASI_Rn02_00224455 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172524 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158359 predicted 1363
2 SASI_Mm02_00344122 predicted 902
3 SASI_Mm01_00158360 predicted 1196
4 SASI_Mm01_00158361 predicted 1111
5 SASI_Mm01_00158363 predicted 196
6 SASI_Mm01_00158364 predicted 1020
7 SASI_Mm01_00158365 predicted 394
8 SASI_Mm01_00158366 predicted 1275
9 SASI_Mm01_00158367 predicted 329
10 SASI_Mm01_00158368 predicted 1123
11 SASI_Mm01_00158362 predicted 1115
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172524
NIPAL4 MISSION shRNA Bacterial Glycerol Stock
NIPA-like domain containing 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172524.1-316s1c1
Sequence:CCGGCTTAAGAAGAAAGGCCTCATTCTCGAGAATGAGGCCTTTCTTCTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175081    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172524.1-3099s1c1
Sequence:CCGGGCTGTATTTCTTAGTACCATTCTCGAGAATGGTACTAAGAAATACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172524.1-1119s1c1
Sequence:CCGGCGCTTTCAAGGATTTGGACATCTCGAGATGTCCAAATCCTTGAAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172524.3-1504s21c1
Sequence:CCGGATACAGCCTTGGTGACTAAATCTCGAGATTTAGTCACCAAGGCTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172524.3-934s21c1
Sequence:CCGGTCAACAGGGCACTGGATATTTCTCGAGAAATATCCAGTGCCCTGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172524.3-190s21c1
Sequence:CCGGGTCCTGAAGAGCCCTACAATGCTCGAGCATTGTAGGGCTCTTCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172524.3-592s21c1
Sequence:CCGGGCAGCACAGTGATGGTCATACCTCGAGGTATGACCATCACTGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172524.3-670s21c1
Sequence:CCGGACACAGGGTTCATCGTCTTTGCTCGAGCAAAGACGATGAACCCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172524
NIPAL4 MISSION shRNA shRNA Plasmid DNA
NIPA-like domain containing 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172524.1-316s1c1
Sequence:CCGGCTTAAGAAGAAAGGCCTCATTCTCGAGAATGAGGCCTTTCTTCTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175081    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172524.1-3099s1c1
Sequence:CCGGGCTGTATTTCTTAGTACCATTCTCGAGAATGGTACTAAGAAATACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172524.1-1119s1c1
Sequence:CCGGCGCTTTCAAGGATTTGGACATCTCGAGATGTCCAAATCCTTGAAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172524.3-1504s21c1
Sequence:CCGGATACAGCCTTGGTGACTAAATCTCGAGATTTAGTCACCAAGGCTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172524.3-934s21c1
Sequence:CCGGTCAACAGGGCACTGGATATTTCTCGAGAAATATCCAGTGCCCTGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172524.3-190s21c1
Sequence:CCGGGTCCTGAAGAGCCCTACAATGCTCGAGCATTGTAGGGCTCTTCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172524.3-592s21c1
Sequence:CCGGGCAGCACAGTGATGGTCATACCTCGAGGTATGACCATCACTGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172524.3-670s21c1
Sequence:CCGGACACAGGGTTCATCGTCTTTGCTCGAGCAAAGACGATGAACCCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172524
NIPAL4 MISSION shRNA Lentiviral Transduction Particles
NIPA-like domain containing 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172524.1-316s1c1
Sequence:CCGGCTTAAGAAGAAAGGCCTCATTCTCGAGAATGAGGCCTTTCTTCTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175081    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172524.1-3099s1c1
Sequence:CCGGGCTGTATTTCTTAGTACCATTCTCGAGAATGGTACTAAGAAATACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172524.1-1119s1c1
Sequence:CCGGCGCTTTCAAGGATTTGGACATCTCGAGATGTCCAAATCCTTGAAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172524.3-1504s21c1
Sequence:CCGGATACAGCCTTGGTGACTAAATCTCGAGATTTAGTCACCAAGGCTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172524.3-934s21c1
Sequence:CCGGTCAACAGGGCACTGGATATTTCTCGAGAAATATCCAGTGCCCTGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172524.3-190s21c1
Sequence:CCGGGTCCTGAAGAGCCCTACAATGCTCGAGCATTGTAGGGCTCTTCAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172524.3-592s21c1
Sequence:CCGGGCAGCACAGTGATGGTCATACCTCGAGGTATGACCATCACTGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172524.3-670s21c1
Sequence:CCGGACACAGGGTTCATCGTCTTTGCTCGAGCAAAGACGATGAACCCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099287
VALIDATED
NIPAL4 MISSION shRNA Bacterial Glycerol Stock
NIPA-like domain containing 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001099287.1-728s21c1
Sequence:CCGGTGCCATCCTCTCCTCATATTTCTCGAGAAATATGAGGAGAGGATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001099287.1-1403s21c1
Sequence:CCGGCCCGGAACCCACTGTTATTAGCTCGAGCTAATAACAGTGGGTTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099287.1-1944s21c1
Sequence:CCGGTCTAGCCCAAGGATGACATAGCTCGAGCTATGTCATCCTTGGGCTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099287.1-883s21c1
Sequence:CCGGACACAGGGTTCATCGTGTTTGCTCGAGCAAACACGATGAACCCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099287.1-1436s21c1
Sequence:CCGGGAACGTCCTTGTGGACAATATCTCGAGATATTGTCCACAAGGACGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099287
VALIDATED
NIPAL4 MISSION shRNA shRNA Plasmid DNA
NIPA-like domain containing 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001099287.1-728s21c1
Sequence:CCGGTGCCATCCTCTCCTCATATTTCTCGAGAAATATGAGGAGAGGATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001099287.1-1403s21c1
Sequence:CCGGCCCGGAACCCACTGTTATTAGCTCGAGCTAATAACAGTGGGTTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099287.1-1944s21c1
Sequence:CCGGTCTAGCCCAAGGATGACATAGCTCGAGCTATGTCATCCTTGGGCTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099287.1-883s21c1
Sequence:CCGGACACAGGGTTCATCGTGTTTGCTCGAGCAAACACGATGAACCCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099287.1-1436s21c1
Sequence:CCGGGAACGTCCTTGTGGACAATATCTCGAGATATTGTCCACAAGGACGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099287
VALIDATED
NIPAL4 MISSION shRNA Lentiviral Transduction Particles
NIPA-like domain containing 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001099287.1-728s21c1
Sequence:CCGGTGCCATCCTCTCCTCATATTTCTCGAGAAATATGAGGAGAGGATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001099287.1-1403s21c1
Sequence:CCGGCCCGGAACCCACTGTTATTAGCTCGAGCTAATAACAGTGGGTTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099287.1-1944s21c1
Sequence:CCGGTCTAGCCCAAGGATGACATAGCTCGAGCTATGTCATCCTTGGGCTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099287.1-883s21c1
Sequence:CCGGACACAGGGTTCATCGTGTTTGCTCGAGCAAACACGATGAACCCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099287.1-1436s21c1
Sequence:CCGGGAACGTCCTTGTGGACAATATCTCGAGATATTGTCCACAAGGACGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)