EMAIL THIS PAGE TO A FRIEND

NIPSNAP1

nipsnap homolog 1 (C. elegans)

61 Gene Product Result for
UniProtKB ID: Q9BPW8, B2RAY3, O43800
Gene ID:
Human(8508) Summary: This gene encodes a member of the NipSnap family of proteins that may be involved in vesicular transport. A similar protein in mice inhibits the calcium channel TRPV6, and is also localized to the inner mitochondrial membrane where it may play a role in mitochondrial DNA maintenance. A pseudogene of this gene is located on the short arm of chromosome 17. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Mouse(18082) 4-nitrophenylphosphatase domain and non-neuronal SNAP25-like protein homolog 1 (C. elegans)
Rat(360971) nipsnap homolog 1 (C. elegans)
Zebrafish(30231) nipsnap1
dog(611870) nipsnap homolog 1 (C. elegans)
cow(614972) nipsnap homolog 1 (C. elegans)
domestic cat(101093895) nipsnap homolog 1 (C. elegans)
chicken(417018) nipsnap homolog 1 (C. elegans)
domestic guinea pig(100715647) nipsnap homolog 1 (C. elegans)
naked mole-rat(101705119) nipsnap homolog 1 (C. elegans)
sheep(101121972) nipsnap homolog 1 (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008698 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008698 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008698 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003634 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003634 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003634 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003634 Rosetta Predictions human pricing
XM_001067526 Rosetta Predictions rat pricing
XM_341249 Rosetta Predictions rat pricing
NM_008698 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087668 predicted 447
2 SASI_Hs01_00087670 predicted 1347
3 SASI_Hs01_00087671 predicted 929
4 SASI_Hs01_00087672 predicted 342
5 SASI_Hs01_00087673 predicted 1055
6 SASI_Hs01_00087674 predicted 1318
7 SASI_Hs02_00335987 predicted 910
8 SASI_Hs01_00087676 predicted 1246
9 SASI_Hs01_00087677 predicted 649
10 SASI_Hs02_00335988 predicted 567
11 SASI_Hs01_00087669 predicted 1257
12 SASI_Hs01_00087675 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321277 predicted 888
2 SASI_Rn02_00321278 predicted 783
3 SASI_Rn02_00321279 predicted 729
4 SASI_Rn02_00321280 predicted 395
5 SASI_Rn02_00321281 predicted 884
6 SASI_Rn02_00321282 predicted 481
7 SASI_Rn02_00321283 predicted 446
8 SASI_Rn02_00321284 predicted 551
9 SASI_Rn02_00321285 predicted 670
10 SASI_Rn02_00321286 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00192494 predicted 891
2 SASI_Rn01_00192495 predicted 784
3 SASI_Rn01_00192496 predicted 735
4 SASI_Rn01_00192498 predicted 394
5 SASI_Rn01_00192499 predicted 878
6 SASI_Rn01_00192500 predicted 478
7 SASI_Rn01_00192502 predicted 447
8 SASI_Rn01_00192503 predicted 551
9 SASI_Rn02_00392643 predicted 667
10 SASI_Rn02_00392644 predicted 382
11 SASI_Rn01_00192497 predicted 541
12 SASI_Rn01_00192501 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008698 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051837 predicted 799
2 SASI_Mm01_00051838 predicted 961
3 SASI_Mm01_00051839 predicted 396
4 SASI_Mm01_00051840 predicted 808
5 SASI_Mm01_00051841 predicted 675
6 SASI_Mm01_00051842 predicted 554
7 SASI_Mm01_00051843 predicted 708
8 SASI_Mm01_00051844 predicted 800
9 SASI_Mm01_00051845 predicted 317
10 SASI_Mm01_00051846 predicted 977
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008698
VALIDATED
NIPSNAP1 MISSION shRNA Bacterial Glycerol Stock
nipsnap homolog 1 (C. elegans)
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008698.1-814s1c1
Sequence:CCGGGAGTCACGAATCATGATTCCTCTCGAGAGGAATCATGATTCGTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008698.1-1629s1c1
Sequence:CCGGGCTCTTCTGTACTTCTTCCTTCTCGAGAAGGAAGAAGTACAGAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008698.1-198s1c1
Sequence:CCGGGAAGGAGACTAGTAATCTCTACTCGAGTAGAGATTACTAGTCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008698.1-561s1c1
Sequence:CCGGGCTGAGGACATATAAACTCAACTCGAGTTGAGTTTATATGTCCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008698.1-548s1c1
Sequence:CCGGCCAATATCTATGAGCTGAGGACTCGAGTCCTCAGCTCATAGATATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008698.1-209s1c1
Sequence:CCGGGTAATCTCTACAAGATCCAGTCTCGAGACTGGATCTTGTAGAGATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008698.1-204s1c1
Sequence:CCGGGACTAGTAATCTCTACAAGATCTCGAGATCTTGTAGAGATTACTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008698.2-212s21c1
Sequence:CCGGATCTCTACAAGATCCAGTTTCCTCGAGGAAACTGGATCTTGTAGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008698.2-1162s21c1
Sequence:CCGGGGCCATGGCTTAGTTGCATAACTCGAGTTATGCAACTAAGCCATGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008698.2-687s21c1
Sequence:CCGGCTACGTGGTACACCACTTATGCTCGAGCATAAGTGGTGTACCACGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008698.2-814s21c1
Sequence:CCGGGAGTCACGAATCATGATTCCTCTCGAGAGGAATCATGATTCGTGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008698.2-1674s1c1
Sequence:CCGGGACCTATAGTTCCATCAAATTCTCGAGAATTTGATGGAACTATAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008698.2-971s21c1
Sequence:CCGGTGGTGTTCAGCTTCGACAAAGCTCGAGCTTTGTCGAAGCTGAACACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008698.2-561s21c1
Sequence:CCGGGCTGAGGACATATAAACTCAACTCGAGTTGAGTTTATATGTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008698
VALIDATED
NIPSNAP1 MISSION shRNA shRNA Plasmid DNA
nipsnap homolog 1 (C. elegans)
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008698.1-814s1c1
Sequence:CCGGGAGTCACGAATCATGATTCCTCTCGAGAGGAATCATGATTCGTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008698.1-1629s1c1
Sequence:CCGGGCTCTTCTGTACTTCTTCCTTCTCGAGAAGGAAGAAGTACAGAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008698.1-198s1c1
Sequence:CCGGGAAGGAGACTAGTAATCTCTACTCGAGTAGAGATTACTAGTCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008698.1-561s1c1
Sequence:CCGGGCTGAGGACATATAAACTCAACTCGAGTTGAGTTTATATGTCCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008698.1-548s1c1
Sequence:CCGGCCAATATCTATGAGCTGAGGACTCGAGTCCTCAGCTCATAGATATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008698.1-209s1c1
Sequence:CCGGGTAATCTCTACAAGATCCAGTCTCGAGACTGGATCTTGTAGAGATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008698.1-204s1c1
Sequence:CCGGGACTAGTAATCTCTACAAGATCTCGAGATCTTGTAGAGATTACTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008698.2-212s21c1
Sequence:CCGGATCTCTACAAGATCCAGTTTCCTCGAGGAAACTGGATCTTGTAGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008698.2-1162s21c1
Sequence:CCGGGGCCATGGCTTAGTTGCATAACTCGAGTTATGCAACTAAGCCATGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008698.2-687s21c1
Sequence:CCGGCTACGTGGTACACCACTTATGCTCGAGCATAAGTGGTGTACCACGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008698.2-814s21c1
Sequence:CCGGGAGTCACGAATCATGATTCCTCTCGAGAGGAATCATGATTCGTGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008698.2-1674s1c1
Sequence:CCGGGACCTATAGTTCCATCAAATTCTCGAGAATTTGATGGAACTATAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008698.2-971s21c1
Sequence:CCGGTGGTGTTCAGCTTCGACAAAGCTCGAGCTTTGTCGAAGCTGAACACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008698.2-561s21c1
Sequence:CCGGGCTGAGGACATATAAACTCAACTCGAGTTGAGTTTATATGTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008698
VALIDATED
NIPSNAP1 MISSION shRNA Lentiviral Transduction Particles
nipsnap homolog 1 (C. elegans)
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008698.1-814s1c1
Sequence:CCGGGAGTCACGAATCATGATTCCTCTCGAGAGGAATCATGATTCGTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008698.1-1629s1c1
Sequence:CCGGGCTCTTCTGTACTTCTTCCTTCTCGAGAAGGAAGAAGTACAGAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008698.1-198s1c1
Sequence:CCGGGAAGGAGACTAGTAATCTCTACTCGAGTAGAGATTACTAGTCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008698.1-561s1c1
Sequence:CCGGGCTGAGGACATATAAACTCAACTCGAGTTGAGTTTATATGTCCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008698.1-548s1c1
Sequence:CCGGCCAATATCTATGAGCTGAGGACTCGAGTCCTCAGCTCATAGATATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008698.1-209s1c1
Sequence:CCGGGTAATCTCTACAAGATCCAGTCTCGAGACTGGATCTTGTAGAGATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008698.1-204s1c1
Sequence:CCGGGACTAGTAATCTCTACAAGATCTCGAGATCTTGTAGAGATTACTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008698.2-212s21c1
Sequence:CCGGATCTCTACAAGATCCAGTTTCCTCGAGGAAACTGGATCTTGTAGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008698.2-1162s21c1
Sequence:CCGGGGCCATGGCTTAGTTGCATAACTCGAGTTATGCAACTAAGCCATGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008698.2-687s21c1
Sequence:CCGGCTACGTGGTACACCACTTATGCTCGAGCATAAGTGGTGTACCACGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008698.2-814s21c1
Sequence:CCGGGAGTCACGAATCATGATTCCTCTCGAGAGGAATCATGATTCGTGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008698.2-1674s1c1
Sequence:CCGGGACCTATAGTTCCATCAAATTCTCGAGAATTTGATGGAACTATAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008698.2-971s21c1
Sequence:CCGGTGGTGTTCAGCTTCGACAAAGCTCGAGCTTTGTCGAAGCTGAACACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008698.2-561s21c1
Sequence:CCGGGCTGAGGACATATAAACTCAACTCGAGTTGAGTTTATATGTCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003634
VALIDATED
NIPSNAP1 MISSION shRNA Bacterial Glycerol Stock
nipsnap homolog 1 (C. elegans)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-960s1c1
Sequence:CCGGGCCTATAAAGACCTGCAGTCTCTCGAGAGACTGCAGGTCTTTATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-467s1c1
Sequence:CCGGCTATAAGATCCAGTTTCACAACTCGAGTTGTGAAACTGGATCTTATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-1256s1c1
Sequence:CCGGGCTGACAAGTTCTGAGGATTACTCGAGTAATCCTCAGAACTTGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-489s1c1
Sequence:CCGGGTAAAGCCTGAATACCTGGATCTCGAGATCCAGGTATTCAGGCTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-1061s1c1
Sequence:CCGGCATGGAGTCTAGGATCATGATCTCGAGATCATGATCCTAGACTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-473s1c1
Sequence:CCGGGATCCAGTTTCACAATGTAAACTCGAGTTTACATTGTGAAACTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-686s1c1
Sequence:CCGGCAATAAGGAGTACCTGGAGTTCTCGAGAACTCCAGGTACTCCTTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003634.1-387s1c1
Sequence:CCGGCGCTCCCTCTTTGTTCACAAACTCGAGTTTGTGAACAAAGAGGGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-656s1c1
Sequence:CCGGCCTCATGGACTGCATGAACAACTCGAGTTGTTCATGCAGTCCATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003634
VALIDATED
NIPSNAP1 MISSION shRNA shRNA Plasmid DNA
nipsnap homolog 1 (C. elegans)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-960s1c1
Sequence:CCGGGCCTATAAAGACCTGCAGTCTCTCGAGAGACTGCAGGTCTTTATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-467s1c1
Sequence:CCGGCTATAAGATCCAGTTTCACAACTCGAGTTGTGAAACTGGATCTTATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-1256s1c1
Sequence:CCGGGCTGACAAGTTCTGAGGATTACTCGAGTAATCCTCAGAACTTGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-489s1c1
Sequence:CCGGGTAAAGCCTGAATACCTGGATCTCGAGATCCAGGTATTCAGGCTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-1061s1c1
Sequence:CCGGCATGGAGTCTAGGATCATGATCTCGAGATCATGATCCTAGACTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-473s1c1
Sequence:CCGGGATCCAGTTTCACAATGTAAACTCGAGTTTACATTGTGAAACTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-686s1c1
Sequence:CCGGCAATAAGGAGTACCTGGAGTTCTCGAGAACTCCAGGTACTCCTTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003634.1-387s1c1
Sequence:CCGGCGCTCCCTCTTTGTTCACAAACTCGAGTTTGTGAACAAAGAGGGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-656s1c1
Sequence:CCGGCCTCATGGACTGCATGAACAACTCGAGTTGTTCATGCAGTCCATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003634
VALIDATED
NIPSNAP1 MISSION shRNA Lentiviral Transduction Particles
nipsnap homolog 1 (C. elegans)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-960s1c1
Sequence:CCGGGCCTATAAAGACCTGCAGTCTCTCGAGAGACTGCAGGTCTTTATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-467s1c1
Sequence:CCGGCTATAAGATCCAGTTTCACAACTCGAGTTGTGAAACTGGATCTTATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-1256s1c1
Sequence:CCGGGCTGACAAGTTCTGAGGATTACTCGAGTAATCCTCAGAACTTGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-489s1c1
Sequence:CCGGGTAAAGCCTGAATACCTGGATCTCGAGATCCAGGTATTCAGGCTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-1061s1c1
Sequence:CCGGCATGGAGTCTAGGATCATGATCTCGAGATCATGATCCTAGACTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-473s1c1
Sequence:CCGGGATCCAGTTTCACAATGTAAACTCGAGTTTACATTGTGAAACTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-686s1c1
Sequence:CCGGCAATAAGGAGTACCTGGAGTTCTCGAGAACTCCAGGTACTCCTTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003634.1-387s1c1
Sequence:CCGGCGCTCCCTCTTTGTTCACAAACTCGAGTTTGTGAACAAAGAGGGAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003634.1-656s1c1
Sequence:CCGGCCTCATGGACTGCATGAACAACTCGAGTTGTTCATGCAGTCCATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)