EMAIL THIS PAGE TO A FRIEND

NIPSNAP3B

nipsnap homolog 3B (C. elegans)

119 Gene Product Result for
Synonyms: NIPSNAP3
UniProtKB ID: Q9BS92, Q5VX30, Q9NUM2
Gene ID:
Human(55335) Summary: NIPSNAP3B belongs to a family of proteins with putative roles in vesicular trafficking (Buechler et al., 2004 [PubMed 15177564]
Mouse(66536) nipsnap homolog 3B (C. elegans)
Rat(313211) nipsnap homolog 3B (C. elegans)
dog(481650) nipsnap homolog 3B (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA042491 Anti-NIPSNAP3A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1102533 Anti-NIPSNAP3B (51-65) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
PRS4957 Anti-NIPSNAP3B antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA047909 Anti-NIPSNAP3B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA047925 Anti-NIPSNAP3B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA049256 Anti-NIPSNAP3B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2900779 Anti-NIPSNAP3B antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB1307014 ANTI-NIPSNAP3B(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025623 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025623 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025623 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018376 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126961 MISSION® esiRNA esiRNA human NIPSNAP3B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018376 Rosetta Predictions human pricing
NM_001009422 Rosetta Predictions rat pricing
XM_001055152 Rosetta Predictions rat pricing
XM_001055213 Rosetta Predictions rat pricing
NM_025623 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157511 predicted 239
2 SASI_Hs01_00157513 predicted 396
3 SASI_Hs01_00157514 predicted 846
4 SASI_Hs01_00157515 predicted 439
5 SASI_Hs01_00157516 predicted 246
6 SASI_Hs01_00157517 predicted 619
7 SASI_Hs01_00157518 predicted 442
8 SASI_Hs01_00157512 predicted 453
9 SASI_Hs01_00157519 predicted 569
10 SASI_Hs01_00157520 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036483 predicted 370
2 SASI_Rn01_00036484 predicted 623
3 SASI_Rn01_00036485 predicted 835
4 SASI_Rn01_00036486 predicted 670
5 SASI_Rn01_00036487 predicted 368
6 SASI_Rn01_00036488 predicted 887
7 SASI_Rn01_00036489 predicted 676
8 SASI_Rn01_00036490 predicted 483
9 SASI_Rn01_00036491 predicted 238
10 SASI_Rn01_00036492 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278616 predicted 276
2 SASI_Rn02_00278617 predicted 536
3 SASI_Rn02_00278618 predicted 745
4 SASI_Rn02_00278619 predicted 585
5 SASI_Rn02_00278620 predicted 271
6 SASI_Rn02_00278621 predicted 799
7 SASI_Rn02_00278622 predicted 581
8 SASI_Rn02_00278623 predicted 386
9 SASI_Rn02_00278624 predicted 262
10 SASI_Rn02_00278625 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055213 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278828 predicted 340
2 SASI_Rn02_00278829 predicted 598
3 SASI_Rn02_00278830 predicted 807
4 SASI_Rn02_00278831 predicted 644
5 SASI_Rn02_00278832 predicted 338
6 SASI_Rn02_00278833 predicted 856
7 SASI_Rn02_00278834 predicted 651
8 SASI_Rn02_00278835 predicted 445
9 SASI_Rn02_00278836 predicted 207
10 SASI_Rn02_00278837 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025623 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117163 predicted 392
2 SASI_Mm01_00117164 predicted 262
3 SASI_Mm01_00117165 predicted 315
4 SASI_Mm01_00117166 predicted 1080
5 SASI_Mm02_00328678 predicted 644
6 SASI_Mm01_00117168 predicted 273
7 SASI_Mm01_00117169 predicted 340
8 SASI_Mm01_00117170 predicted 843
9 SASI_Mm01_00117171 predicted 614
10 SASI_Mm01_00117172 predicted 951
11 SASI_Mm01_00117167 predicted 1039
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025623
VALIDATED
NIPSNAP3B MISSION shRNA Bacterial Glycerol Stock
nipsnap homolog 3B (C. elegans)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025623.2-731s21c1
Sequence:CCGGGTTCGGGAGAGTGTCAGTTACCTCGAGGTAACTGACACTCTCCCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025623.2-261s21c1
Sequence:CCGGACTCTGAAATGATTGGCTATTCTCGAGAATAGCCAATCATTTCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025623.2-194s21c1
Sequence:CCGGCTCAAGCCCTCAAAGACAAATCTCGAGATTTGTCTTTGAGGGCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025623.1-771s1c1
Sequence:CCGGCGTTCCTGATTCCAACATCATCTCGAGATGATGTTGGAATCAGGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025623.2-945s21c1
Sequence:CCGGTGAAGGCTACCTGAGTCATTTCTCGAGAAATGACTCAGGTAGCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025623.2-397s21c1
Sequence:CCGGACGATTCCTCATTCCAAATTTCTCGAGAAATTTGGAATGAGGAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025623.1-1345s1c1
Sequence:CCGGCCTTGAGACTTGGTGTATAATCTCGAGATTATACACCAAGTCTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025623.1-155s1c1
Sequence:CCGGCAAAGCAATGGCACATTCTATCTCGAGATAGAATGTGCCATTGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025623
VALIDATED
NIPSNAP3B MISSION shRNA shRNA Plasmid DNA
nipsnap homolog 3B (C. elegans)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025623.2-731s21c1
Sequence:CCGGGTTCGGGAGAGTGTCAGTTACCTCGAGGTAACTGACACTCTCCCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025623.2-261s21c1
Sequence:CCGGACTCTGAAATGATTGGCTATTCTCGAGAATAGCCAATCATTTCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025623.2-194s21c1
Sequence:CCGGCTCAAGCCCTCAAAGACAAATCTCGAGATTTGTCTTTGAGGGCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025623.1-771s1c1
Sequence:CCGGCGTTCCTGATTCCAACATCATCTCGAGATGATGTTGGAATCAGGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025623.2-945s21c1
Sequence:CCGGTGAAGGCTACCTGAGTCATTTCTCGAGAAATGACTCAGGTAGCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025623.2-397s21c1
Sequence:CCGGACGATTCCTCATTCCAAATTTCTCGAGAAATTTGGAATGAGGAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025623.1-1345s1c1
Sequence:CCGGCCTTGAGACTTGGTGTATAATCTCGAGATTATACACCAAGTCTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025623.1-155s1c1
Sequence:CCGGCAAAGCAATGGCACATTCTATCTCGAGATAGAATGTGCCATTGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025623
VALIDATED
NIPSNAP3B MISSION shRNA Lentiviral Transduction Particles
nipsnap homolog 3B (C. elegans)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025623.2-731s21c1
Sequence:CCGGGTTCGGGAGAGTGTCAGTTACCTCGAGGTAACTGACACTCTCCCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025623.2-261s21c1
Sequence:CCGGACTCTGAAATGATTGGCTATTCTCGAGAATAGCCAATCATTTCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025623.2-194s21c1
Sequence:CCGGCTCAAGCCCTCAAAGACAAATCTCGAGATTTGTCTTTGAGGGCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025623.1-771s1c1
Sequence:CCGGCGTTCCTGATTCCAACATCATCTCGAGATGATGTTGGAATCAGGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025623.2-945s21c1
Sequence:CCGGTGAAGGCTACCTGAGTCATTTCTCGAGAAATGACTCAGGTAGCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025623.2-397s21c1
Sequence:CCGGACGATTCCTCATTCCAAATTTCTCGAGAAATTTGGAATGAGGAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025623.1-1345s1c1
Sequence:CCGGCCTTGAGACTTGGTGTATAATCTCGAGATTATACACCAAGTCTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025623.1-155s1c1
Sequence:CCGGCAAAGCAATGGCACATTCTATCTCGAGATAGAATGTGCCATTGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018376
NIPSNAP3B MISSION shRNA Bacterial Glycerol Stock
nipsnap homolog 3B (C. elegans)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018376.2-381s1c1
Sequence:CCGGGCCAACTGTAAGGAATGGCAACTCGAGTTGCCATTCCTTACAGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018376.2-779s1c1
Sequence:CCGGGCTTCTGATTCCTGCATCATTCTCGAGAATGATGCAGGAATCAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018376.2-172s1c1
Sequence:CCGGGAACGTTCTATGAATTTCGTACTCGAGTACGAAATTCATAGAACGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018376.2-849s1c1
Sequence:CCGGGCTCTAAGATGTGTCTGCTAACTCGAGTTAGCAGACACATCTTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018376.2-371s1c1
Sequence:CCGGGAAAGCCTTAGCCAACTGTAACTCGAGTTACAGTTGGCTAAGGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018376.2-446s1c1
Sequence:CCGGGACGGAAATTACTTACCTGATCTCGAGATCAGGTAAGTAATTTCCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018376
NIPSNAP3B MISSION shRNA shRNA Plasmid DNA
nipsnap homolog 3B (C. elegans)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018376.2-381s1c1
Sequence:CCGGGCCAACTGTAAGGAATGGCAACTCGAGTTGCCATTCCTTACAGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018376.2-779s1c1
Sequence:CCGGGCTTCTGATTCCTGCATCATTCTCGAGAATGATGCAGGAATCAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018376.2-172s1c1
Sequence:CCGGGAACGTTCTATGAATTTCGTACTCGAGTACGAAATTCATAGAACGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018376.2-849s1c1
Sequence:CCGGGCTCTAAGATGTGTCTGCTAACTCGAGTTAGCAGACACATCTTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018376.2-371s1c1
Sequence:CCGGGAAAGCCTTAGCCAACTGTAACTCGAGTTACAGTTGGCTAAGGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018376.2-446s1c1
Sequence:CCGGGACGGAAATTACTTACCTGATCTCGAGATCAGGTAAGTAATTTCCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018376
NIPSNAP3B MISSION shRNA Lentiviral Transduction Particles
nipsnap homolog 3B (C. elegans)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018376.2-381s1c1
Sequence:CCGGGCCAACTGTAAGGAATGGCAACTCGAGTTGCCATTCCTTACAGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018376.2-779s1c1
Sequence:CCGGGCTTCTGATTCCTGCATCATTCTCGAGAATGATGCAGGAATCAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018376.2-172s1c1
Sequence:CCGGGAACGTTCTATGAATTTCGTACTCGAGTACGAAATTCATAGAACGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018376.2-849s1c1
Sequence:CCGGGCTCTAAGATGTGTCTGCTAACTCGAGTTAGCAGACACATCTTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018376.2-371s1c1
Sequence:CCGGGAAAGCCTTAGCCAACTGTAACTCGAGTTACAGTTGGCTAAGGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018376.2-446s1c1
Sequence:CCGGGACGGAAATTACTTACCTGATCTCGAGATCAGGTAAGTAATTTCCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)