EMAIL THIS PAGE TO A FRIEND

NISCH

nischarin

225 Gene Product Result for
Synonyms: I-1 IR1 IRAS hIRAS
Gene ID:
Human(11188) Summary: This gene encodes a nonadrenergic imidazoline-1 receptor protein that localizes to the cytosol and anchors to the inner layer of the plasma membrane. The orthologous mouse protein has been shown to influence cytoskeletal organization and cell migration by binding to alpha-5-beta-1 integrin. In humans, this protein has been shown to bind to the adapter insulin receptor substrate 4 (IRS4) to mediate translocation of alpha-5 integrin from the cell membrane to endosomes. Expression of this protein was reduced in human breast cancers while its overexpression reduced tumor growth and metastasis; possibly by limiting the expression of alpha-5 integrin. In human cardiac tissue, this gene was found to affect cell growth and death while in neural tissue it affected neuronal growth and differentiation. Alternative splicing results in multiple transcript variants encoding differerent isoforms. Some isoforms lack the expected C-terminal domains of a functional imidazoline receptor. [provided by RefSeq, Jan 2013]
Mouse(64652) nischarin
Rat(306255) nischarin
Zebrafish(553087) nischarin
chicken(415893) nischarin
cow(515009) nischarin
cow(100336473) nischarin
Horse(100060179) nischarin
dog(476594) nischarin
sheep(101111584) nischarin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
R134 Rilmenidine hemifumarate salt solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022656 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022656 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022656 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007184 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007184 Rosetta Predictions human pricing
XM_001057307 Rosetta Predictions rat pricing
XM_001058707 Rosetta Predictions rat pricing
XM_001058760 Rosetta Predictions rat pricing
XM_240330 Rosetta Predictions rat pricing
NM_022656 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116360 predicted 4569
2 SASI_Hs02_00343150 predicted 2720
3 SASI_Hs01_00116361 predicted 677
4 SASI_Hs01_00116362 predicted 2488
5 SASI_Hs01_00116363 predicted 682
6 SASI_Hs01_00116364 predicted 4056
7 SASI_Hs01_00116365 predicted 2886
8 SASI_Hs02_00343151 predicted 3986
9 SASI_Hs01_00116367 predicted 1102
10 SASI_Hs01_00116369 predicted 4320
11 SASI_Hs01_00116366 predicted 864
12 SASI_Hs01_00116368 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057307 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285953 predicted 2923
2 SASI_Rn02_00285954 predicted 2676
3 SASI_Rn02_00285955 predicted 988
4 SASI_Rn02_00285956 predicted 2617
5 SASI_Rn02_00285957 predicted 3051
6 SASI_Rn02_00285958 predicted 3223
7 SASI_Rn02_00285959 predicted 1563
8 SASI_Rn02_00285960 predicted 3099
9 SASI_Rn02_00285961 predicted 2979
10 SASI_Rn02_00285962 predicted 3221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290608 predicted 1031
2 SASI_Rn02_00290609 predicted 4011
3 SASI_Rn02_00290610 predicted 3472
4 SASI_Rn02_00290611 predicted 625
5 SASI_Rn02_00290612 predicted 708
6 SASI_Rn02_00290613 predicted 1312
7 SASI_Rn02_00290614 predicted 4321
8 SASI_Rn02_00290615 predicted 1686
9 SASI_Rn02_00290616 predicted 720
10 SASI_Rn02_00290617 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290794 predicted 2924
2 SASI_Rn02_00290795 predicted 2671
3 SASI_Rn02_00290796 predicted 987
4 SASI_Rn02_00290797 predicted 2618
5 SASI_Rn02_00290798 predicted 3045
6 SASI_Rn02_00290799 predicted 3229
7 SASI_Rn02_00290800 predicted 1570
8 SASI_Rn02_00290801 predicted 3098
9 SASI_Rn02_00290802 predicted 2979
10 SASI_Rn02_00290803 predicted 3221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_240330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391594 predicted 1037
2 SASI_Rn02_00391595 predicted 4009
3 SASI_Rn02_00391596 predicted 3471
4 SASI_Rn02_00391597 predicted 617
5 SASI_Rn02_00391598 predicted 706
6 SASI_Rn02_00391599 predicted 1314
7 SASI_Rn02_00391600 predicted 4321
8 SASI_Rn02_00391601 predicted 1688
9 SASI_Rn02_00391602 predicted 717
10 SASI_Rn02_00391603 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022656 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035058 predicted 1329
2 SASI_Mm02_00326630 predicted 706
3 SASI_Mm01_00035059 predicted 3867
4 SASI_Mm01_00035062 predicted 2776
5 SASI_Mm02_00326631 predicted 1284
6 SASI_Mm02_00326632 predicted 3208
7 SASI_Mm02_00326633 predicted 660
8 SASI_Mm02_00326634 predicted 4588
9 SASI_Mm02_00326635 predicted 877
10 SASI_Mm02_00326636 predicted 1693
11 SASI_Mm01_00035060 predicted 1128
12 SASI_Mm01_00035061 predicted 3742
13 SASI_Mm01_00035063 predicted 4050
14 SASI_Mm01_00035064 predicted 482
15 SASI_Mm01_00035065 predicted 1261
16 SASI_Mm01_00035066 predicted 817
17 SASI_Mm01_00035067 predicted 2533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022656
VALIDATED
NISCH MISSION shRNA Bacterial Glycerol Stock
nischarin
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022656.2-1146s21c1
Sequence:CCGGGATAACCTGCAGCACCTATACCTCGAGGTATAGGTGCTGCAGGTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022656.2-5052s21c1
Sequence:CCGGCCTTGGTTCCTACATTGATTGCTCGAGCAATCAATGTAGGAACCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022656.1-506s1c1
Sequence:CCGGGAGATCGACGAATCTGTGAAACTCGAGTTTCACAGATTCGTCGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022656.2-289s21c1
Sequence:CCGGACCATGAGTGGACGATCAAACCTCGAGGTTTGATCGTCCACTCATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022656.2-4596s21c1
Sequence:CCGGCACTATCCATTGCCTGAATTTCTCGAGAAATTCAGGCAATGGATAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022656.2-710s21c1
Sequence:CCGGAGACTTCACCTGTCGCCTTAACTCGAGTTAAGGCGACAGGTGAAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022656.1-511s1c1
Sequence:CCGGCGACGAATCTGTGAAACTGATCTCGAGATCAGTTTCACAGATTCGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022656.1-4589s1c1
Sequence:CCGGGAAGTGTTAAGTCCAGTCCTTCTCGAGAAGGACTGGACTTAACACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022656.1-3440s1c1
Sequence:CCGGGCTGTGTACTTCATACTGCATCTCGAGATGCAGTATGAAGTACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022656.1-2341s1c1
Sequence:CCGGCCAGCATCTCAACGTCATCAACTCGAGTTGATGACGTTGAGATGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022656.1-3916s1c1
Sequence:CCGGCCTCAGCATCTTACTGTACATCTCGAGATGTACAGTAAGATGCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022656.2-719s1c1
Sequence:CCGGCTGTCGCCTTAAGTATCTTAACTCGAGTTAAGATACTTAAGGCGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022656
VALIDATED
NISCH MISSION shRNA shRNA Plasmid DNA
nischarin
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022656.2-1146s21c1
Sequence:CCGGGATAACCTGCAGCACCTATACCTCGAGGTATAGGTGCTGCAGGTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022656.2-5052s21c1
Sequence:CCGGCCTTGGTTCCTACATTGATTGCTCGAGCAATCAATGTAGGAACCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022656.1-506s1c1
Sequence:CCGGGAGATCGACGAATCTGTGAAACTCGAGTTTCACAGATTCGTCGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022656.2-289s21c1
Sequence:CCGGACCATGAGTGGACGATCAAACCTCGAGGTTTGATCGTCCACTCATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022656.2-4596s21c1
Sequence:CCGGCACTATCCATTGCCTGAATTTCTCGAGAAATTCAGGCAATGGATAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022656.2-710s21c1
Sequence:CCGGAGACTTCACCTGTCGCCTTAACTCGAGTTAAGGCGACAGGTGAAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022656.1-511s1c1
Sequence:CCGGCGACGAATCTGTGAAACTGATCTCGAGATCAGTTTCACAGATTCGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022656.1-4589s1c1
Sequence:CCGGGAAGTGTTAAGTCCAGTCCTTCTCGAGAAGGACTGGACTTAACACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022656.1-3440s1c1
Sequence:CCGGGCTGTGTACTTCATACTGCATCTCGAGATGCAGTATGAAGTACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022656.1-2341s1c1
Sequence:CCGGCCAGCATCTCAACGTCATCAACTCGAGTTGATGACGTTGAGATGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022656.1-3916s1c1
Sequence:CCGGCCTCAGCATCTTACTGTACATCTCGAGATGTACAGTAAGATGCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022656.2-719s1c1
Sequence:CCGGCTGTCGCCTTAAGTATCTTAACTCGAGTTAAGATACTTAAGGCGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022656
VALIDATED
NISCH MISSION shRNA Lentiviral Transduction Particles
nischarin
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022656.2-1146s21c1
Sequence:CCGGGATAACCTGCAGCACCTATACCTCGAGGTATAGGTGCTGCAGGTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022656.2-5052s21c1
Sequence:CCGGCCTTGGTTCCTACATTGATTGCTCGAGCAATCAATGTAGGAACCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022656.1-506s1c1
Sequence:CCGGGAGATCGACGAATCTGTGAAACTCGAGTTTCACAGATTCGTCGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022656.2-289s21c1
Sequence:CCGGACCATGAGTGGACGATCAAACCTCGAGGTTTGATCGTCCACTCATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022656.2-4596s21c1
Sequence:CCGGCACTATCCATTGCCTGAATTTCTCGAGAAATTCAGGCAATGGATAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022656.2-710s21c1
Sequence:CCGGAGACTTCACCTGTCGCCTTAACTCGAGTTAAGGCGACAGGTGAAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022656.1-511s1c1
Sequence:CCGGCGACGAATCTGTGAAACTGATCTCGAGATCAGTTTCACAGATTCGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022656.1-4589s1c1
Sequence:CCGGGAAGTGTTAAGTCCAGTCCTTCTCGAGAAGGACTGGACTTAACACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022656.1-3440s1c1
Sequence:CCGGGCTGTGTACTTCATACTGCATCTCGAGATGCAGTATGAAGTACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022656.1-2341s1c1
Sequence:CCGGCCAGCATCTCAACGTCATCAACTCGAGTTGATGACGTTGAGATGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022656.1-3916s1c1
Sequence:CCGGCCTCAGCATCTTACTGTACATCTCGAGATGTACAGTAAGATGCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022656.2-719s1c1
Sequence:CCGGCTGTCGCCTTAAGTATCTTAACTCGAGTTAAGATACTTAAGGCGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007184
NISCH MISSION shRNA Bacterial Glycerol Stock
nischarin
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-1974s1c1
Sequence:CCGGGCTGAGAACCGCTACTTTGAACTCGAGTTCAAAGTAGCGGTTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007184.3-1784s21c1
Sequence:CCGGACAGGCAGCTTCCGATGATTTCTCGAGAAATCATCGGAAGCTGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-690s1c1
Sequence:CCGGGTGGAGATAAGTCACTGTGATCTCGAGATCACAGTGACTTATCTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-3662s1c1
Sequence:CCGGCGACTACAACAACAGCCCTTTCTCGAGAAAGGGCTGTTGTTGTAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-1013s1c1
Sequence:CCGGGCACCTGTATAACCTTGTGCACTCGAGTGCACAAGGTTATACAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-3884s1c1
Sequence:CCGGGCCTGTTGACAAGGACTTCTACTCGAGTAGAAGTCCTTGTCAACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-1637s1c1
Sequence:CCGGCCAGGGATGTTCTGATTCCTTCTCGAGAAGGAATCAGAACATCCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007184.3-686s21c1
Sequence:CCGGCTGTCGCCTTAAGTACCTTAACTCGAGTTAAGGTACTTAAGGCGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007184.3-4906s21c1
Sequence:CCGGCTGTTGTGGGACCGTTGTTAACTCGAGTTAACAACGGTCCCACAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007184.3-760s21c1
Sequence:CCGGTGCCGTTCGACCTATCAATATCTCGAGATATTGATAGGTCGAACGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007184.3-4066s21c1
Sequence:CCGGACTCTAGTCGCGTCAAGTTTACTCGAGTAAACTTGACGCGACTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007184
NISCH MISSION shRNA shRNA Plasmid DNA
nischarin
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-1974s1c1
Sequence:CCGGGCTGAGAACCGCTACTTTGAACTCGAGTTCAAAGTAGCGGTTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007184.3-1784s21c1
Sequence:CCGGACAGGCAGCTTCCGATGATTTCTCGAGAAATCATCGGAAGCTGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-690s1c1
Sequence:CCGGGTGGAGATAAGTCACTGTGATCTCGAGATCACAGTGACTTATCTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-3662s1c1
Sequence:CCGGCGACTACAACAACAGCCCTTTCTCGAGAAAGGGCTGTTGTTGTAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-1013s1c1
Sequence:CCGGGCACCTGTATAACCTTGTGCACTCGAGTGCACAAGGTTATACAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-3884s1c1
Sequence:CCGGGCCTGTTGACAAGGACTTCTACTCGAGTAGAAGTCCTTGTCAACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-1637s1c1
Sequence:CCGGCCAGGGATGTTCTGATTCCTTCTCGAGAAGGAATCAGAACATCCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007184.3-686s21c1
Sequence:CCGGCTGTCGCCTTAAGTACCTTAACTCGAGTTAAGGTACTTAAGGCGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007184.3-4906s21c1
Sequence:CCGGCTGTTGTGGGACCGTTGTTAACTCGAGTTAACAACGGTCCCACAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007184.3-760s21c1
Sequence:CCGGTGCCGTTCGACCTATCAATATCTCGAGATATTGATAGGTCGAACGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007184.3-4066s21c1
Sequence:CCGGACTCTAGTCGCGTCAAGTTTACTCGAGTAAACTTGACGCGACTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007184
NISCH MISSION shRNA Lentiviral Transduction Particles
nischarin
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-1974s1c1
Sequence:CCGGGCTGAGAACCGCTACTTTGAACTCGAGTTCAAAGTAGCGGTTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007184.3-1784s21c1
Sequence:CCGGACAGGCAGCTTCCGATGATTTCTCGAGAAATCATCGGAAGCTGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-690s1c1
Sequence:CCGGGTGGAGATAAGTCACTGTGATCTCGAGATCACAGTGACTTATCTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-3662s1c1
Sequence:CCGGCGACTACAACAACAGCCCTTTCTCGAGAAAGGGCTGTTGTTGTAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-1013s1c1
Sequence:CCGGGCACCTGTATAACCTTGTGCACTCGAGTGCACAAGGTTATACAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-3884s1c1
Sequence:CCGGGCCTGTTGACAAGGACTTCTACTCGAGTAGAAGTCCTTGTCAACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007184.1-1637s1c1
Sequence:CCGGCCAGGGATGTTCTGATTCCTTCTCGAGAAGGAATCAGAACATCCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007184.3-686s21c1
Sequence:CCGGCTGTCGCCTTAAGTACCTTAACTCGAGTTAAGGTACTTAAGGCGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007184.3-4906s21c1
Sequence:CCGGCTGTTGTGGGACCGTTGTTAACTCGAGTTAACAACGGTCCCACAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007184.3-760s21c1
Sequence:CCGGTGCCGTTCGACCTATCAATATCTCGAGATATTGATAGGTCGAACGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007184.3-4066s21c1
Sequence:CCGGACTCTAGTCGCGTCAAGTTTACTCGAGTAAACTTGACGCGACTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)