EMAIL THIS PAGE TO A FRIEND

NIT1

nitrilase 1

108 Gene Product Result for
UniProtKB ID: Q86X76, B1AQP3, D3DVF4, O76091
Gene ID:
Human(4817) Summary: This gene encodes a member of the nitrilase protein family with homology to bacterial and plant nitrilases, enzymes that cleave nitriles and organic amides to the corresponding carboxylic acids plus ammonia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Mouse(27045) nitrilase 1
Rat(289222) nitrilase 1
Thale Cress(823556) nitrilase 1
chicken(429566) nitrilase 1
Zebrafish(447900) nitrilase 1
dog(478977) nitrilase 1
cow(504199) nitrilase 1
sheep(101102354) nitrilase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012049 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012049 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012049 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005600 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005600 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005600 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005600 Rosetta Predictions human pricing
NM_001082580 Rosetta Predictions rat pricing
NM_182668 Rosetta Predictions rat pricing
NM_012049 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121226 predicted 537
2 SASI_Hs01_00121227 predicted 1051
3 SASI_Hs01_00121228 predicted 729
4 SASI_Hs01_00121229 predicted 530
5 SASI_Hs01_00121230 predicted 472
6 SASI_Hs01_00121231 predicted 552
7 SASI_Hs01_00121232 predicted 538
8 SASI_Hs01_00121233 predicted 552
9 SASI_Hs01_00121234 predicted 869
10 SASI_Hs01_00121235 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082580 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208809 predicted 353
2 SASI_Rn02_00208810 predicted 842
3 SASI_Rn02_00208811 predicted 565
4 SASI_Rn02_00208812 predicted 974
5 SASI_Rn02_00208813 predicted 590
6 SASI_Rn02_00208814 predicted 385
7 SASI_Rn02_00208815 predicted 529
8 SASI_Rn02_00208816 predicted 765
9 SASI_Rn02_00208817 predicted 621
10 SASI_Rn02_00208818 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269811 predicted 317
2 SASI_Rn01_00069287 predicted 805
3 SASI_Rn01_00069288 predicted 525
4 SASI_Rn01_00069289 predicted 939
5 SASI_Rn01_00069290 predicted 558
6 SASI_Rn02_00269812 predicted 347
7 SASI_Rn01_00069293 predicted 501
8 SASI_Rn01_00069294 predicted 729
9 SASI_Rn01_00069296 predicted 592
10 SASI_Rn02_00269813 predicted 1011
11 SASI_Rn01_00069291 predicted 967
12 SASI_Rn01_00069292 predicted 335
13 SASI_Rn01_00069295 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012049 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125968 predicted 285
2 SASI_Mm01_00125969 predicted 722
3 SASI_Mm01_00125970 predicted 837
4 SASI_Mm01_00125971 predicted 469
5 SASI_Mm01_00125972 predicted 219
6 SASI_Mm01_00125973 predicted 332
7 SASI_Mm01_00125974 predicted 784
8 SASI_Mm01_00125975 predicted 926
9 SASI_Mm01_00125976 predicted 593
10 SASI_Mm01_00125977 predicted 638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012049
VALIDATED
NIT1 MISSION shRNA Bacterial Glycerol Stock
nitrilase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012049.1-786s21c1
Sequence:CCGGTGAATCTCAGTGCTATGTAATCTCGAGATTACATAGCACTGAGATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012049.1-1043s21c1
Sequence:CCGGTGTTGGTTAAGACACAGACACCTCGAGGTGTCTGTGTCTTAACCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012049.1-567s21c1
Sequence:CCGGGATGAGAGAAAGCAACTATACCTCGAGGTATAGTTGCTTTCTCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012049.1-94s21c1
Sequence:CCGGCTGTGTACCGGATACCGATTACTCGAGTAATCGGTATCCGGTACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012049.1-322s21c1
Sequence:CCGGCGAAACCCTGCCGAGACATTACTCGAGTAATGTCTCGGCAGGGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012049.1-925s1c1
Sequence:CCGGGCTCGAATTGATCTCCACTTTCTCGAGAAAGTGGAGATCAATTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012049.1-1128s1c1
Sequence:CCGGGCAGAACTTTAACCTCTCTTACTCGAGTAAGAGAGGTTAAAGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012049.1-201s1c1
Sequence:CCGGCCAGGTAACATCAACACCAAACTCGAGTTTGGTGTTGATGTTACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012049.1-298s1c1
Sequence:CCGGCCTGAGGCATTTGACTTTATTCTCGAGAATAAAGTCAAATGCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012049
VALIDATED
NIT1 MISSION shRNA shRNA Plasmid DNA
nitrilase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012049.1-786s21c1
Sequence:CCGGTGAATCTCAGTGCTATGTAATCTCGAGATTACATAGCACTGAGATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012049.1-1043s21c1
Sequence:CCGGTGTTGGTTAAGACACAGACACCTCGAGGTGTCTGTGTCTTAACCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012049.1-567s21c1
Sequence:CCGGGATGAGAGAAAGCAACTATACCTCGAGGTATAGTTGCTTTCTCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012049.1-94s21c1
Sequence:CCGGCTGTGTACCGGATACCGATTACTCGAGTAATCGGTATCCGGTACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012049.1-322s21c1
Sequence:CCGGCGAAACCCTGCCGAGACATTACTCGAGTAATGTCTCGGCAGGGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012049.1-925s1c1
Sequence:CCGGGCTCGAATTGATCTCCACTTTCTCGAGAAAGTGGAGATCAATTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012049.1-1128s1c1
Sequence:CCGGGCAGAACTTTAACCTCTCTTACTCGAGTAAGAGAGGTTAAAGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012049.1-201s1c1
Sequence:CCGGCCAGGTAACATCAACACCAAACTCGAGTTTGGTGTTGATGTTACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012049.1-298s1c1
Sequence:CCGGCCTGAGGCATTTGACTTTATTCTCGAGAATAAAGTCAAATGCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012049
VALIDATED
NIT1 MISSION shRNA Lentiviral Transduction Particles
nitrilase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012049.1-786s21c1
Sequence:CCGGTGAATCTCAGTGCTATGTAATCTCGAGATTACATAGCACTGAGATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012049.1-1043s21c1
Sequence:CCGGTGTTGGTTAAGACACAGACACCTCGAGGTGTCTGTGTCTTAACCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012049.1-567s21c1
Sequence:CCGGGATGAGAGAAAGCAACTATACCTCGAGGTATAGTTGCTTTCTCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012049.1-94s21c1
Sequence:CCGGCTGTGTACCGGATACCGATTACTCGAGTAATCGGTATCCGGTACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012049.1-322s21c1
Sequence:CCGGCGAAACCCTGCCGAGACATTACTCGAGTAATGTCTCGGCAGGGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012049.1-925s1c1
Sequence:CCGGGCTCGAATTGATCTCCACTTTCTCGAGAAAGTGGAGATCAATTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012049.1-1128s1c1
Sequence:CCGGGCAGAACTTTAACCTCTCTTACTCGAGTAAGAGAGGTTAAAGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012049.1-201s1c1
Sequence:CCGGCCAGGTAACATCAACACCAAACTCGAGTTTGGTGTTGATGTTACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012049.1-298s1c1
Sequence:CCGGCCTGAGGCATTTGACTTTATTCTCGAGAATAAAGTCAAATGCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005600
VALIDATED
NIT1 MISSION shRNA Bacterial Glycerol Stock
nitrilase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005600.1-142s21c1
Sequence:CCGGACCTCAACTCTCAGTACTTTGCTCGAGCAAAGTACTGAGAGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005600.1-864s21c1
Sequence:CCGGATGAGAAGAGAGCAAGTTATGCTCGAGCATAACTTGCTCTCTTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_005600.1-956s1c1
Sequence:CCGGGCCCGAATAGACCTCAACTATCTCGAGATAGTTGAGGTCTATTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005600.1-1062s21c1
Sequence:CCGGACTTGACTTCTGTGAGTTTAGCTCGAGCTAAACTCACAGAAGTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005600.1-957s21c1
Sequence:CCGGCCCGAATAGACCTCAACTATCCTCGAGGATAGTTGAGGTCTATTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005600.1-727s21c1
Sequence:CCGGAGCTGGAGCAGAGATACTTACCTCGAGGTAAGTATCTCTGCTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_005600.1-1170s1c1
Sequence:CCGGGAGAACCTTGACTCTCTTGATCTCGAGATCAAGAGAGTCAAGGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_005600.1-329s1c1
Sequence:CCGGCCTGAGGCATTTGACTTCATTCTCGAGAATGAAGTCAAATGCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005600.1-545s1c1
Sequence:CCGGGCCACTTACAGGAAGACACATCTCGAGATGTGTCTTCCTGTAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_005600.1-137s1c1
Sequence:CCGGCGGATACCTCAACTCTCAGTACTCGAGTACTGAGAGTTGAGGTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005600
VALIDATED
NIT1 MISSION shRNA shRNA Plasmid DNA
nitrilase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005600.1-142s21c1
Sequence:CCGGACCTCAACTCTCAGTACTTTGCTCGAGCAAAGTACTGAGAGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005600.1-864s21c1
Sequence:CCGGATGAGAAGAGAGCAAGTTATGCTCGAGCATAACTTGCTCTCTTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_005600.1-956s1c1
Sequence:CCGGGCCCGAATAGACCTCAACTATCTCGAGATAGTTGAGGTCTATTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005600.1-1062s21c1
Sequence:CCGGACTTGACTTCTGTGAGTTTAGCTCGAGCTAAACTCACAGAAGTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005600.1-957s21c1
Sequence:CCGGCCCGAATAGACCTCAACTATCCTCGAGGATAGTTGAGGTCTATTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005600.1-727s21c1
Sequence:CCGGAGCTGGAGCAGAGATACTTACCTCGAGGTAAGTATCTCTGCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_005600.1-1170s1c1
Sequence:CCGGGAGAACCTTGACTCTCTTGATCTCGAGATCAAGAGAGTCAAGGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_005600.1-329s1c1
Sequence:CCGGCCTGAGGCATTTGACTTCATTCTCGAGAATGAAGTCAAATGCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005600.1-545s1c1
Sequence:CCGGGCCACTTACAGGAAGACACATCTCGAGATGTGTCTTCCTGTAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_005600.1-137s1c1
Sequence:CCGGCGGATACCTCAACTCTCAGTACTCGAGTACTGAGAGTTGAGGTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005600
VALIDATED
NIT1 MISSION shRNA Lentiviral Transduction Particles
nitrilase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005600.1-142s21c1
Sequence:CCGGACCTCAACTCTCAGTACTTTGCTCGAGCAAAGTACTGAGAGTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005600.1-864s21c1
Sequence:CCGGATGAGAAGAGAGCAAGTTATGCTCGAGCATAACTTGCTCTCTTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_005600.1-956s1c1
Sequence:CCGGGCCCGAATAGACCTCAACTATCTCGAGATAGTTGAGGTCTATTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005600.1-1062s21c1
Sequence:CCGGACTTGACTTCTGTGAGTTTAGCTCGAGCTAAACTCACAGAAGTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005600.1-957s21c1
Sequence:CCGGCCCGAATAGACCTCAACTATCCTCGAGGATAGTTGAGGTCTATTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005600.1-727s21c1
Sequence:CCGGAGCTGGAGCAGAGATACTTACCTCGAGGTAAGTATCTCTGCTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_005600.1-1170s1c1
Sequence:CCGGGAGAACCTTGACTCTCTTGATCTCGAGATCAAGAGAGTCAAGGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_005600.1-329s1c1
Sequence:CCGGCCTGAGGCATTTGACTTCATTCTCGAGAATGAAGTCAAATGCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005600.1-545s1c1
Sequence:CCGGGCCACTTACAGGAAGACACATCTCGAGATGTGTCTTCCTGTAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_005600.1-137s1c1
Sequence:CCGGCGGATACCTCAACTCTCAGTACTCGAGTACTGAGAGTTGAGGTATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)