EMAIL THIS PAGE TO A FRIEND

NIT2

nitrilase family, member 2

51 Gene Product Result for
UniProtKB ID: Q9NQR4, B2R9A3, D3DN47, Q8WUF0
Gene ID:
Mouse(52633) nitrilase family, member 2
Rat(288174) nitrilase family, member 2
sheep(101109231) nitrilase family, member 2
domestic guinea pig(100722536) nitrilase family, member 2
naked mole-rat(101713989) nitrilase family, member 2
Thale Cress(823555) nitrilase 2
Zebrafish(402904) nitrilase family, member 2
chicken(418386) nitrilase family, member 2
cow(520620) nitrilase family, member 2
domestic cat(101093040) nitrilase family, member 2
dog(478540) nitrilase family, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020202 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023175 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023175 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023175 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU051401 MISSION® esiRNA esiRNA targeting mouse Nit2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020202 Rosetta Predictions human pricing
NM_001034126 Rosetta Predictions rat pricing
NM_023175 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056595 predicted 618
2 SASI_Hs01_00056596 predicted 655
3 SASI_Hs01_00056597 predicted 558
4 SASI_Hs01_00056598 predicted 719
5 SASI_Hs01_00056599 predicted 395
6 SASI_Hs01_00056600 predicted 402
7 SASI_Hs01_00056601 predicted 288
8 SASI_Hs01_00056602 predicted 270
9 SASI_Hs01_00056603 predicted 293
10 SASI_Hs01_00056604 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034126 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089982 predicted 446
2 SASI_Rn02_00203958 predicted 636
3 SASI_Rn01_00089984 predicted 369
4 SASI_Rn01_00089985 predicted 782
5 SASI_Rn01_00089986 predicted 351
6 SASI_Rn01_00089987 predicted 620
7 SASI_Rn01_00089988 predicted 298
8 SASI_Rn01_00089989 predicted 557
9 SASI_Rn01_00089990 predicted 377
10 SASI_Rn02_00203959 predicted 301
11 SASI_Rn01_00089983 predicted 246
12 SASI_Rn01_00089991 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135896 predicted 630
2 SASI_Mm01_00135897 predicted 346
3 SASI_Mm01_00135898 predicted 348
4 SASI_Mm01_00135899 predicted 200
5 SASI_Mm01_00135900 predicted 643
6 SASI_Mm01_00135901 predicted 264
7 SASI_Mm01_00135902 predicted 267
8 SASI_Mm01_00135903 predicted 515
9 SASI_Mm02_00326899 predicted 301
10 SASI_Mm01_00135904 predicted 377
11 SASI_Mm01_00135905 predicted 335
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020202
VALIDATED
NIT2 MISSION shRNA Bacterial Glycerol Stock
nitrilase family, member 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020202.4-413s21c1
Sequence:CCGGCCATCTGTTTGACATTGATGTCTCGAGACATCAATGTCAAACAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020202.4-784s21c1
Sequence:CCGGCAGAAGAAGCAATCGTGTATTCTCGAGAATACACGATTGCTTCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020202.4-953s21c1
Sequence:CCGGACATAATCAACTCCCTATTAACTCGAGTTAATAGGGAGTTGATTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020202.4-291s21c1
Sequence:CCGGGCAAAGGAATGCAGCATATATCTCGAGATATATGCTGCATTCCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020202.4-792s21c1
Sequence:CCGGGCAATCGTGTATTCAGACATACTCGAGTATGTCTGAATACACGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020202.2-799s1c1
Sequence:CCGGGTATTCAGACATAGACCTGAACTCGAGTTCAGGTCTATGTCTGAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020202.2-783s1c1
Sequence:CCGGCAGAAGAAGCAATCGTGTATTCTCGAGAATACACGATTGCTTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020202.2-198s1c1
Sequence:CCGGCGGAATGCTTTAATTCTCCATCTCGAGATGGAGAATTAAAGCATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020202.2-117s1c1
Sequence:CCGGCCATCAAATCAGATAACGTCACTCGAGTGACGTTATCTGATTTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020202.2-412s1c1
Sequence:CCGGCCATCTGTTTGACATTGATGTCTCGAGACATCAATGTCAAACAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020202.2-791s1c1
Sequence:CCGGGCAATCGTGTATTCAGACATACTCGAGTATGTCTGAATACACGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020202.2-659s1c1
Sequence:CCGGGCTGTTGATAATCAGGTGTATCTCGAGATACACCTGATTATCAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020202
VALIDATED
NIT2 MISSION shRNA shRNA Plasmid DNA
nitrilase family, member 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020202.4-413s21c1
Sequence:CCGGCCATCTGTTTGACATTGATGTCTCGAGACATCAATGTCAAACAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020202.4-784s21c1
Sequence:CCGGCAGAAGAAGCAATCGTGTATTCTCGAGAATACACGATTGCTTCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020202.4-953s21c1
Sequence:CCGGACATAATCAACTCCCTATTAACTCGAGTTAATAGGGAGTTGATTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020202.4-291s21c1
Sequence:CCGGGCAAAGGAATGCAGCATATATCTCGAGATATATGCTGCATTCCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020202.4-792s21c1
Sequence:CCGGGCAATCGTGTATTCAGACATACTCGAGTATGTCTGAATACACGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020202.2-799s1c1
Sequence:CCGGGTATTCAGACATAGACCTGAACTCGAGTTCAGGTCTATGTCTGAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020202.2-783s1c1
Sequence:CCGGCAGAAGAAGCAATCGTGTATTCTCGAGAATACACGATTGCTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020202.2-198s1c1
Sequence:CCGGCGGAATGCTTTAATTCTCCATCTCGAGATGGAGAATTAAAGCATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020202.2-117s1c1
Sequence:CCGGCCATCAAATCAGATAACGTCACTCGAGTGACGTTATCTGATTTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020202.2-412s1c1
Sequence:CCGGCCATCTGTTTGACATTGATGTCTCGAGACATCAATGTCAAACAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020202.2-791s1c1
Sequence:CCGGGCAATCGTGTATTCAGACATACTCGAGTATGTCTGAATACACGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020202.2-659s1c1
Sequence:CCGGGCTGTTGATAATCAGGTGTATCTCGAGATACACCTGATTATCAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020202
VALIDATED
NIT2 MISSION shRNA Lentiviral Transduction Particles
nitrilase family, member 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020202.4-413s21c1
Sequence:CCGGCCATCTGTTTGACATTGATGTCTCGAGACATCAATGTCAAACAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020202.4-784s21c1
Sequence:CCGGCAGAAGAAGCAATCGTGTATTCTCGAGAATACACGATTGCTTCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020202.4-953s21c1
Sequence:CCGGACATAATCAACTCCCTATTAACTCGAGTTAATAGGGAGTTGATTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020202.4-291s21c1
Sequence:CCGGGCAAAGGAATGCAGCATATATCTCGAGATATATGCTGCATTCCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020202.4-792s21c1
Sequence:CCGGGCAATCGTGTATTCAGACATACTCGAGTATGTCTGAATACACGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020202.2-799s1c1
Sequence:CCGGGTATTCAGACATAGACCTGAACTCGAGTTCAGGTCTATGTCTGAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020202.2-783s1c1
Sequence:CCGGCAGAAGAAGCAATCGTGTATTCTCGAGAATACACGATTGCTTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020202.2-198s1c1
Sequence:CCGGCGGAATGCTTTAATTCTCCATCTCGAGATGGAGAATTAAAGCATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020202.2-117s1c1
Sequence:CCGGCCATCAAATCAGATAACGTCACTCGAGTGACGTTATCTGATTTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020202.2-412s1c1
Sequence:CCGGCCATCTGTTTGACATTGATGTCTCGAGACATCAATGTCAAACAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020202.2-791s1c1
Sequence:CCGGGCAATCGTGTATTCAGACATACTCGAGTATGTCTGAATACACGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020202.2-659s1c1
Sequence:CCGGGCTGTTGATAATCAGGTGTATCTCGAGATACACCTGATTATCAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023175
VALIDATED
NIT2 MISSION shRNA Bacterial Glycerol Stock
nitrilase family, member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023175.1-631s21c1
Sequence:CCGGGCTGTTGATAATCAGGTGTATCTCGAGATACACCTGATTATCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023175.1-439s21c1
Sequence:CCGGTTGAGCCCTGGTGATAGTTTCCTCGAGGAAACTATCACCAGGGCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023175.1-1082s21c1
Sequence:CCGGTCTGATGGTTCCTAGGCATTTCTCGAGAAATGCCTAGGAACCATCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023175.1-351s21c1
Sequence:CCGGTGATGGAAGTTTACTGGTAAACTCGAGTTTACCAGTAAACTTCCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023175.1-841s21c1
Sequence:CCGGGCAGACCTCTATACAGTGGAACTCGAGTTCCACTGTATAGAGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023175.1-1139s1c1
Sequence:CCGGGCCTCTAAGCATTGTTTCCATCTCGAGATGGAAACAATGCTTAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023175.1-631s1c1
Sequence:CCGGGCTGTTGATAATCAGGTGTATCTCGAGATACACCTGATTATCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023175.1-797s1c1
Sequence:CCGGTGGCTGAAATTCGGCAGCAAACTCGAGTTTGCTGCCGAATTTCAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023175.1-526s1c1
Sequence:CCGGCTTGCACAAATCTATGCACAACTCGAGTTGTGCATAGATTTGTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023175.1-841s1c1
Sequence:CCGGGCAGACCTCTATACAGTGGAACTCGAGTTCCACTGTATAGAGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023175
VALIDATED
NIT2 MISSION shRNA shRNA Plasmid DNA
nitrilase family, member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023175.1-631s21c1
Sequence:CCGGGCTGTTGATAATCAGGTGTATCTCGAGATACACCTGATTATCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023175.1-439s21c1
Sequence:CCGGTTGAGCCCTGGTGATAGTTTCCTCGAGGAAACTATCACCAGGGCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023175.1-1082s21c1
Sequence:CCGGTCTGATGGTTCCTAGGCATTTCTCGAGAAATGCCTAGGAACCATCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023175.1-351s21c1
Sequence:CCGGTGATGGAAGTTTACTGGTAAACTCGAGTTTACCAGTAAACTTCCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023175.1-841s21c1
Sequence:CCGGGCAGACCTCTATACAGTGGAACTCGAGTTCCACTGTATAGAGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023175.1-1139s1c1
Sequence:CCGGGCCTCTAAGCATTGTTTCCATCTCGAGATGGAAACAATGCTTAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023175.1-631s1c1
Sequence:CCGGGCTGTTGATAATCAGGTGTATCTCGAGATACACCTGATTATCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023175.1-797s1c1
Sequence:CCGGTGGCTGAAATTCGGCAGCAAACTCGAGTTTGCTGCCGAATTTCAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023175.1-526s1c1
Sequence:CCGGCTTGCACAAATCTATGCACAACTCGAGTTGTGCATAGATTTGTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023175.1-841s1c1
Sequence:CCGGGCAGACCTCTATACAGTGGAACTCGAGTTCCACTGTATAGAGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023175
VALIDATED
NIT2 MISSION shRNA Lentiviral Transduction Particles
nitrilase family, member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023175.1-631s21c1
Sequence:CCGGGCTGTTGATAATCAGGTGTATCTCGAGATACACCTGATTATCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023175.1-439s21c1
Sequence:CCGGTTGAGCCCTGGTGATAGTTTCCTCGAGGAAACTATCACCAGGGCTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023175.1-1082s21c1
Sequence:CCGGTCTGATGGTTCCTAGGCATTTCTCGAGAAATGCCTAGGAACCATCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023175.1-351s21c1
Sequence:CCGGTGATGGAAGTTTACTGGTAAACTCGAGTTTACCAGTAAACTTCCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023175.1-841s21c1
Sequence:CCGGGCAGACCTCTATACAGTGGAACTCGAGTTCCACTGTATAGAGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023175.1-1139s1c1
Sequence:CCGGGCCTCTAAGCATTGTTTCCATCTCGAGATGGAAACAATGCTTAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023175.1-631s1c1
Sequence:CCGGGCTGTTGATAATCAGGTGTATCTCGAGATACACCTGATTATCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023175.1-797s1c1
Sequence:CCGGTGGCTGAAATTCGGCAGCAAACTCGAGTTTGCTGCCGAATTTCAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023175.1-526s1c1
Sequence:CCGGCTTGCACAAATCTATGCACAACTCGAGTTGTGCATAGATTTGTGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023175.1-841s1c1
Sequence:CCGGGCAGACCTCTATACAGTGGAACTCGAGTTCCACTGTATAGAGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)