EMAIL THIS PAGE TO A FRIEND

NKAIN1

Na+/K+ transporting ATPase interacting 1

118 Gene Product Result for
Synonyms: FAM77C
UniProtKB ID: Q4KMZ8, A2VDJ3, B7Z5W9, Q9H9M7
Gene ID:
Human(79570) Summary: NKAIN1 is a member of a family of mammalian proteins with similarity to Drosophila Nkain and interacts with the beta subunit of Na,K-ATPase (ATP1B1; MIM 182330) (Gorokhova et al., 2007 [PubMed 17606467]
Mouse(67149) Na+/K+ transporting ATPase interacting 1
Rat(500557) Na+/K+ transporting ATPase interacting 1
Zebrafish(393517) Na+/K+ transporting ATPase interacting 1
cow(618218) Na+/K+ transporting ATPase interacting 1
domestic cat(101094521) Na+/K+ transporting ATPase interacting 1
dog(611917) Na+/K+ transporting ATPase interacting 1
chicken(768785) Na+/K+ transporting ATPase interacting 1
domestic guinea pig(100732389) Na+/K+ transporting ATPase interacting 1
naked mole-rat(101700919) Na+/K+ transporting ATPase interacting 1
sheep(101107769) Na+/K+ transporting ATPase interacting 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025998 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025998 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025998 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024522 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024522 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024522 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121411 MISSION® esiRNA esiRNA human NKAIN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024522 Rosetta Predictions human pricing
XM_001062503 Rosetta Predictions rat pricing
XM_575920 Rosetta Predictions rat pricing
NM_025998 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035726 predicted 398
2 SASI_Hs01_00035727 predicted 450
3 SASI_Hs01_00035728 predicted 393
4 SASI_Hs01_00035729 predicted 250
5 SASI_Hs01_00035730 predicted 291
6 SASI_Hs01_00035731 predicted 139
7 SASI_Hs01_00035732 predicted 849
8 SASI_Hs01_00035733 predicted 906
9 SASI_Hs02_00356802 predicted 140
10 SASI_Hs01_00035735 predicted 153
11 SASI_Hs01_00035734 predicted 47
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303678 predicted 508
2 SASI_Rn02_00303679 predicted 457
3 SASI_Rn02_00303680 predicted 374
4 SASI_Rn02_00303681 predicted 534
5 SASI_Rn02_00303682 predicted 270
6 SASI_Rn02_00303683 predicted 538
7 SASI_Rn02_00303684 predicted 311
8 SASI_Rn02_00303685 predicted 379
9 SASI_Rn02_00303686 predicted 345
10 SASI_Rn02_00303687 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404518 predicted 199
2 SASI_Rn02_00404519 predicted 222
3 SASI_Rn02_00404520 predicted 243
4 SASI_Rn02_00404521 predicted 257
5 SASI_Rn02_00404522 predicted 208
6 SASI_Rn02_00404523 predicted 222
7 SASI_Rn02_00404524 predicted 236
8 SASI_Rn02_00404525 predicted 231
9 SASI_Rn02_00404526 predicted 216
10 SASI_Rn02_00404527 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188150 predicted 724
2 SASI_Mm02_00329450 predicted 699
3 SASI_Mm02_00329451 predicted 251
4 SASI_Mm01_00188155 predicted 641
5 SASI_Mm02_00329452 predicted 216
6 SASI_Mm02_00329453 predicted 395
7 SASI_Mm02_00329454 predicted 452
8 SASI_Mm01_00188156 predicted 722
9 SASI_Mm02_00329455 predicted 249
10 SASI_Mm01_00188157 predicted 597
11 SASI_Mm01_00188149 predicted 567
12 SASI_Mm01_00188151 predicted 473
13 SASI_Mm01_00188152 predicted 582
14 SASI_Mm01_00188153 predicted 661
15 SASI_Mm01_00188154 predicted 508
16 SASI_Mm01_00188158 predicted 553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025998
VALIDATED
NKAIN1 MISSION shRNA Bacterial Glycerol Stock
Na+/K+ transporting ATPase interacting 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175752    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025998.1-1019s1c1
Sequence:CCGGGCTCTACTCCTTACCTAGTATCTCGAGATACTAGGTAAGGAGTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025998.1-514s1c1
Sequence:CCGGCTTACATTGAAGCCCTCAGTACTCGAGTACTGAGGGCTTCAATGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025998.3-729s21c1
Sequence:CCGGCCGCAGAAGACGTCGCATTTACTCGAGTAAATGCGACGTCTTCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025998.3-1896s21c1
Sequence:CCGGGAATGAGAGTGGGTGACTATGCTCGAGCATAGTCACCCACTCTCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025998.3-221s21c1
Sequence:CCGGCCAGCGGCAGATCTTCGATTTCTCGAGAAATCGAAGATCTGCCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025998.3-560s21c1
Sequence:CCGGCACTGGCTGCCTGCTTGATTACTCGAGTAATCAAGCAGGCAGCCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025998
VALIDATED
NKAIN1 MISSION shRNA shRNA Plasmid DNA
Na+/K+ transporting ATPase interacting 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175752    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025998.1-1019s1c1
Sequence:CCGGGCTCTACTCCTTACCTAGTATCTCGAGATACTAGGTAAGGAGTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025998.1-514s1c1
Sequence:CCGGCTTACATTGAAGCCCTCAGTACTCGAGTACTGAGGGCTTCAATGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025998.3-729s21c1
Sequence:CCGGCCGCAGAAGACGTCGCATTTACTCGAGTAAATGCGACGTCTTCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025998.3-1896s21c1
Sequence:CCGGGAATGAGAGTGGGTGACTATGCTCGAGCATAGTCACCCACTCTCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025998.3-221s21c1
Sequence:CCGGCCAGCGGCAGATCTTCGATTTCTCGAGAAATCGAAGATCTGCCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025998.3-560s21c1
Sequence:CCGGCACTGGCTGCCTGCTTGATTACTCGAGTAATCAAGCAGGCAGCCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025998
VALIDATED
NKAIN1 MISSION shRNA Lentiviral Transduction Particles
Na+/K+ transporting ATPase interacting 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175752    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025998.1-1019s1c1
Sequence:CCGGGCTCTACTCCTTACCTAGTATCTCGAGATACTAGGTAAGGAGTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025998.1-514s1c1
Sequence:CCGGCTTACATTGAAGCCCTCAGTACTCGAGTACTGAGGGCTTCAATGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025998.3-729s21c1
Sequence:CCGGCCGCAGAAGACGTCGCATTTACTCGAGTAAATGCGACGTCTTCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025998.3-1896s21c1
Sequence:CCGGGAATGAGAGTGGGTGACTATGCTCGAGCATAGTCACCCACTCTCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025998.3-221s21c1
Sequence:CCGGCCAGCGGCAGATCTTCGATTTCTCGAGAAATCGAAGATCTGCCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025998.3-560s21c1
Sequence:CCGGCACTGGCTGCCTGCTTGATTACTCGAGTAATCAAGCAGGCAGCCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024522
NKAIN1 MISSION shRNA Bacterial Glycerol Stock
Na+/K+ transporting ATPase interacting 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024522.1-133s1c1
Sequence:CCGGGCTGGAATGCATTTATCATCTCTCGAGAGATGATAAATGCATTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024522.1-141s1c1
Sequence:CCGGGCATTTATCATCTGCTTCTACCTCGAGGTAGAAGCAGATGATAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024522.1-458s1c1
Sequence:CCGGCGGCTTTGACTCCTACGGATACTCGAGTATCCGTAGGAGTCAAAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024522.1-1228s1c1
Sequence:CCGGGCCTTGAACACAGTGTACTTTCTCGAGAAAGTACACTGTGTTCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024522.1-300s1c1
Sequence:CCGGCACCATGTCATCTCTGTCACTCTCGAGAGTGACAGAGATGACATGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024522.1-491s1c1
Sequence:CCGGGAAGACGTCGCATTTACAGCTCTCGAGAGCTGTAAATGCGACGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024522.1-2081s1c1
Sequence:CCGGCCTCCAATCTATCATTCCCTACTCGAGTAGGGAATGATAGATTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024522.1-399s21c1
Sequence:CCGGTTCGCCTGCTACGTGAGCAAACTCGAGTTTGCTCACGTAGCAGGCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024522.1-963s21c1
Sequence:CCGGTGTGAACTAGGAGCAGGATTCCTCGAGGAATCCTGCTCCTAGTTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024522
NKAIN1 MISSION shRNA shRNA Plasmid DNA
Na+/K+ transporting ATPase interacting 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024522.1-133s1c1
Sequence:CCGGGCTGGAATGCATTTATCATCTCTCGAGAGATGATAAATGCATTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024522.1-141s1c1
Sequence:CCGGGCATTTATCATCTGCTTCTACCTCGAGGTAGAAGCAGATGATAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024522.1-458s1c1
Sequence:CCGGCGGCTTTGACTCCTACGGATACTCGAGTATCCGTAGGAGTCAAAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024522.1-1228s1c1
Sequence:CCGGGCCTTGAACACAGTGTACTTTCTCGAGAAAGTACACTGTGTTCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024522.1-300s1c1
Sequence:CCGGCACCATGTCATCTCTGTCACTCTCGAGAGTGACAGAGATGACATGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024522.1-491s1c1
Sequence:CCGGGAAGACGTCGCATTTACAGCTCTCGAGAGCTGTAAATGCGACGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024522.1-2081s1c1
Sequence:CCGGCCTCCAATCTATCATTCCCTACTCGAGTAGGGAATGATAGATTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024522.1-399s21c1
Sequence:CCGGTTCGCCTGCTACGTGAGCAAACTCGAGTTTGCTCACGTAGCAGGCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024522.1-963s21c1
Sequence:CCGGTGTGAACTAGGAGCAGGATTCCTCGAGGAATCCTGCTCCTAGTTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024522
NKAIN1 MISSION shRNA Lentiviral Transduction Particles
Na+/K+ transporting ATPase interacting 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024522.1-133s1c1
Sequence:CCGGGCTGGAATGCATTTATCATCTCTCGAGAGATGATAAATGCATTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024522.1-141s1c1
Sequence:CCGGGCATTTATCATCTGCTTCTACCTCGAGGTAGAAGCAGATGATAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024522.1-458s1c1
Sequence:CCGGCGGCTTTGACTCCTACGGATACTCGAGTATCCGTAGGAGTCAAAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024522.1-1228s1c1
Sequence:CCGGGCCTTGAACACAGTGTACTTTCTCGAGAAAGTACACTGTGTTCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024522.1-300s1c1
Sequence:CCGGCACCATGTCATCTCTGTCACTCTCGAGAGTGACAGAGATGACATGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024522.1-491s1c1
Sequence:CCGGGAAGACGTCGCATTTACAGCTCTCGAGAGCTGTAAATGCGACGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024522.1-2081s1c1
Sequence:CCGGCCTCCAATCTATCATTCCCTACTCGAGTAGGGAATGATAGATTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024522.1-399s21c1
Sequence:CCGGTTCGCCTGCTACGTGAGCAAACTCGAGTTTGCTCACGTAGCAGGCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024522.1-963s21c1
Sequence:CCGGTGTGAACTAGGAGCAGGATTCCTCGAGGAATCCTGCTCCTAGTTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)