EMAIL THIS PAGE TO A FRIEND

NKAP

NFKB activating protein

64 Gene Product Result for
UniProtKB ID: Q8N5F7, Q6IPW6, Q96BQ2, Q9H638
Gene ID:
Human(79576) Summary: This gene encodes a protein that is involved in the activation of the ubiquitous transcription factor NF-kappaB. This protein is associated with the the histone deacetylase HDAC3 and with the Notch corepressor complex, and it thereby acts as a transcriptional repressor of Notch target genes. It is also required for alphabeta T cell development. A related pseudogene has been identified on chromosome X, while a related and intronless retrocopy, which has an intact CDS and may be functional, is located on chromosome 6. [provided by RefSeq, May 2010]
Mouse(67050) NFKB activating protein
Rat(298342) NFKB activating protein
naked mole-rat(101708216) NFKB activating protein
sheep(101122925) NFKB activating protein
Zebrafish(336120) NFKB activating protein
chicken(422368) NFKB activating protein
cow(540361) NFKB activating protein
dog(492098) NFKB activating protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
T4376 N-p-Tosyl-L-phenylalanine chloromethyl ketone ≥97% (TLC), powder human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
E7881 Emodin from Frangula bark, ≥90% (HPLC) human pricing
P0667 Parthenolide ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024528 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024528 Rosetta Predictions human pricing
NM_001024872 Rosetta Predictions rat pricing
XM_001063039 Rosetta Predictions rat pricing
NM_025937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223903 predicted 1327
2 SASI_Hs01_00223904 predicted 1238
3 SASI_Hs01_00223905 predicted 1182
4 SASI_Hs01_00223906 predicted 1179
5 SASI_Hs01_00223907 predicted 1192
6 SASI_Hs01_00223908 predicted 239
7 SASI_Hs01_00223909 predicted 222
8 SASI_Hs01_00223910 predicted 1193
9 SASI_Hs01_00223912 predicted 1175
10 SASI_Hs02_00356820 predicted 1417
11 SASI_Hs01_00223911 predicted 1347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024872 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068081 predicted 1118
2 SASI_Rn01_00068082 predicted 283
3 SASI_Rn01_00068083 predicted 1135
4 SASI_Rn01_00068084 predicted 306
5 SASI_Rn01_00068085 predicted 1169
6 SASI_Rn01_00068086 predicted 1114
7 SASI_Rn01_00068088 predicted 1091
8 SASI_Rn02_00202753 predicted 255
9 SASI_Rn01_00068089 predicted 1206
10 SASI_Rn01_00068090 predicted 246
11 SASI_Rn01_00068087 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305552 predicted 1201
2 SASI_Rn02_00305553 predicted 1883
3 SASI_Rn02_00305554 predicted 1203
4 SASI_Rn02_00305555 predicted 1479
5 SASI_Rn02_00305556 predicted 1207
6 SASI_Rn02_00305557 predicted 1223
7 SASI_Rn02_00305558 predicted 1876
8 SASI_Rn02_00305559 predicted 1747
9 SASI_Rn02_00305560 predicted 1148
10 SASI_Rn02_00305561 predicted 1874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181999 predicted 1906
2 SASI_Mm01_00182000 predicted 1832
3 SASI_Mm01_00182001 predicted 1469
4 SASI_Mm01_00182002 predicted 1430
5 SASI_Mm01_00182003 predicted 337
6 SASI_Mm01_00182004 predicted 1345
7 SASI_Mm01_00182005 predicted 1511
8 SASI_Mm01_00182006 predicted 1846
9 SASI_Mm01_00182007 predicted 1835
10 SASI_Mm02_00329324 predicted 1532
11 SASI_Mm01_00182008 predicted 1208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025937
VALIDATED
NKAP MISSION shRNA Bacterial Glycerol Stock
NFKB activating protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179372    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025937.2-3405s1c1
Sequence:CCGGGCCAGGAATTTCCTCTTTGTTCTCGAGAACAAAGAGGAAATTCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025937.3-456s21c1
Sequence:CCGGTGCATCCTCGTCCGCCTATTACTCGAGTAATAGGCGGACGAGGATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025937.3-1380s1c1
Sequence:CCGGCTTTCGTGAGATGGTATACAGCTCGAGCTGTATACCATCTCACGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025937.3-687s1c1
Sequence:CCGGCACTACTTCAGCATCTAGTTCCTCGAGGAACTAGATGCTGAAGTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025937.3-370s21c1
Sequence:CCGGAGCTCCCGAAACCAATCTTACCTCGAGGTAAGATTGGTTTCGGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025937.3-1088s21c1
Sequence:CCGGATGATAAGCCTTTGAACTATGCTCGAGCATAGTTCAAAGGCTTATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025937.3-2320s21c1
Sequence:CCGGGAGTCTATTGTGCCAATATAACTCGAGTTATATTGGCACAATAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025937.3-1378s21c1
Sequence:CCGGAGCTTTCGTGAGATGGTATACCTCGAGGTATACCATCTCACGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025937
VALIDATED
NKAP MISSION shRNA shRNA Plasmid DNA
NFKB activating protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179372    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025937.2-3405s1c1
Sequence:CCGGGCCAGGAATTTCCTCTTTGTTCTCGAGAACAAAGAGGAAATTCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025937.3-456s21c1
Sequence:CCGGTGCATCCTCGTCCGCCTATTACTCGAGTAATAGGCGGACGAGGATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025937.3-1380s1c1
Sequence:CCGGCTTTCGTGAGATGGTATACAGCTCGAGCTGTATACCATCTCACGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025937.3-687s1c1
Sequence:CCGGCACTACTTCAGCATCTAGTTCCTCGAGGAACTAGATGCTGAAGTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025937.3-370s21c1
Sequence:CCGGAGCTCCCGAAACCAATCTTACCTCGAGGTAAGATTGGTTTCGGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025937.3-1088s21c1
Sequence:CCGGATGATAAGCCTTTGAACTATGCTCGAGCATAGTTCAAAGGCTTATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025937.3-2320s21c1
Sequence:CCGGGAGTCTATTGTGCCAATATAACTCGAGTTATATTGGCACAATAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025937.3-1378s21c1
Sequence:CCGGAGCTTTCGTGAGATGGTATACCTCGAGGTATACCATCTCACGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025937
VALIDATED
NKAP MISSION shRNA Lentiviral Transduction Particles
NFKB activating protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179372    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025937.2-3405s1c1
Sequence:CCGGGCCAGGAATTTCCTCTTTGTTCTCGAGAACAAAGAGGAAATTCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025937.3-456s21c1
Sequence:CCGGTGCATCCTCGTCCGCCTATTACTCGAGTAATAGGCGGACGAGGATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025937.3-1380s1c1
Sequence:CCGGCTTTCGTGAGATGGTATACAGCTCGAGCTGTATACCATCTCACGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025937.3-687s1c1
Sequence:CCGGCACTACTTCAGCATCTAGTTCCTCGAGGAACTAGATGCTGAAGTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025937.3-370s21c1
Sequence:CCGGAGCTCCCGAAACCAATCTTACCTCGAGGTAAGATTGGTTTCGGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025937.3-1088s21c1
Sequence:CCGGATGATAAGCCTTTGAACTATGCTCGAGCATAGTTCAAAGGCTTATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025937.3-2320s21c1
Sequence:CCGGGAGTCTATTGTGCCAATATAACTCGAGTTATATTGGCACAATAGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025937.3-1378s21c1
Sequence:CCGGAGCTTTCGTGAGATGGTATACCTCGAGGTATACCATCTCACGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024528
NKAP MISSION shRNA Bacterial Glycerol Stock
NFKB activating protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024528.1-973s1c1
Sequence:CCGGCCCAAGAAGAGTTTCTGGAAACTCGAGTTTCCAGAAACTCTTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024528.1-545s1c1
Sequence:CCGGGCGGCAGAAGAGATTAAGTGACTCGAGTCACTTAATCTCTTCTGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024528.1-923s1c1
Sequence:CCGGGAGGTCTAAGAAGAGCAGAAACTCGAGTTTCTGCTCTTCTTAGACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024528.1-1200s1c1
Sequence:CCGGGCATCATTTGAATGCTCAGGTCTCGAGACCTGAGCATTCAAATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024528.1-1349s1c1
Sequence:CCGGGAACAAGATTCTGGCCAGTTTCTCGAGAAACTGGCCAGAATCTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024528.1-890s1c1
Sequence:CCGGGAAGAAACACAGATCGAAGAACTCGAGTTCTTCGATCTGTGTTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024528.1-716s1c1
Sequence:CCGGGAAGAAGTCTAGCCGTTCAAACTCGAGTTTGAACGGCTAGACTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024528.1-1423s1c1
Sequence:CCGGCTGATTGTCCAGAAGACATTTCTCGAGAAATGTCTTCTGGACAATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024528.1-1017s1c1
Sequence:CCGGGCTGAAGAACCATCAGATTTACTCGAGTAAATCTGATGGTTCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024528.1-1338s1c1
Sequence:CCGGCGAAAGAGAGAGAACAAGATTCTCGAGAATCTTGTTCTCTCTCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024528
NKAP MISSION shRNA shRNA Plasmid DNA
NFKB activating protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024528.1-973s1c1
Sequence:CCGGCCCAAGAAGAGTTTCTGGAAACTCGAGTTTCCAGAAACTCTTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024528.1-545s1c1
Sequence:CCGGGCGGCAGAAGAGATTAAGTGACTCGAGTCACTTAATCTCTTCTGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024528.1-923s1c1
Sequence:CCGGGAGGTCTAAGAAGAGCAGAAACTCGAGTTTCTGCTCTTCTTAGACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024528.1-1200s1c1
Sequence:CCGGGCATCATTTGAATGCTCAGGTCTCGAGACCTGAGCATTCAAATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024528.1-1349s1c1
Sequence:CCGGGAACAAGATTCTGGCCAGTTTCTCGAGAAACTGGCCAGAATCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024528.1-890s1c1
Sequence:CCGGGAAGAAACACAGATCGAAGAACTCGAGTTCTTCGATCTGTGTTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024528.1-716s1c1
Sequence:CCGGGAAGAAGTCTAGCCGTTCAAACTCGAGTTTGAACGGCTAGACTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024528.1-1423s1c1
Sequence:CCGGCTGATTGTCCAGAAGACATTTCTCGAGAAATGTCTTCTGGACAATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024528.1-1017s1c1
Sequence:CCGGGCTGAAGAACCATCAGATTTACTCGAGTAAATCTGATGGTTCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024528.1-1338s1c1
Sequence:CCGGCGAAAGAGAGAGAACAAGATTCTCGAGAATCTTGTTCTCTCTCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024528
NKAP MISSION shRNA Lentiviral Transduction Particles
NFKB activating protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024528.1-973s1c1
Sequence:CCGGCCCAAGAAGAGTTTCTGGAAACTCGAGTTTCCAGAAACTCTTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024528.1-545s1c1
Sequence:CCGGGCGGCAGAAGAGATTAAGTGACTCGAGTCACTTAATCTCTTCTGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024528.1-923s1c1
Sequence:CCGGGAGGTCTAAGAAGAGCAGAAACTCGAGTTTCTGCTCTTCTTAGACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024528.1-1200s1c1
Sequence:CCGGGCATCATTTGAATGCTCAGGTCTCGAGACCTGAGCATTCAAATGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024528.1-1349s1c1
Sequence:CCGGGAACAAGATTCTGGCCAGTTTCTCGAGAAACTGGCCAGAATCTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024528.1-890s1c1
Sequence:CCGGGAAGAAACACAGATCGAAGAACTCGAGTTCTTCGATCTGTGTTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024528.1-716s1c1
Sequence:CCGGGAAGAAGTCTAGCCGTTCAAACTCGAGTTTGAACGGCTAGACTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024528.1-1423s1c1
Sequence:CCGGCTGATTGTCCAGAAGACATTTCTCGAGAAATGTCTTCTGGACAATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024528.1-1017s1c1
Sequence:CCGGGCTGAAGAACCATCAGATTTACTCGAGTAAATCTGATGGTTCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024528.1-1338s1c1
Sequence:CCGGCGAAAGAGAGAGAACAAGATTCTCGAGAATCTTGTTCTCTCTCTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)