EMAIL THIS PAGE TO A FRIEND

NKIRAS1

NFKB inhibitor interacting Ras-like 1

59 Gene Product Result for
Synonyms: KBRAS1 kappaB-Ras1
UniProtKB ID: Q9NYS0, Q96K18
Gene ID:
Mouse(69721) NFKB inhibitor interacting Ras-like protein 1
Rat(305751) NFKB inhibitor interacting Ras-like 1
Goat(100861360) NFKB inhibitor interacting Ras-like 1
sheep(101123267) NFKB inhibitor interacting Ras-like 1
domestic guinea pig(100721961) NFKB inhibitor interacting Ras-like 1
naked mole-rat(101718607) NFKB inhibitor interacting Ras-like 1
Zebrafish(100002175) NFKB inhibitor interacting Ras-like 1
chicken(420654) NFKB inhibitor interacting Ras-like 1
cow(522875) NFKB inhibitor interacting Ras-like 1
domestic cat(101083795) NFKB inhibitor interacting Ras-like 1
dog(477047) NFKB inhibitor interacting Ras-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020345 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020345 Rosetta Predictions human pricing
NM_001107252 Rosetta Predictions rat pricing
XM_223837 Rosetta Predictions rat pricing
NM_023526 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093466 predicted 877
2 SASI_Hs01_00093467 predicted 822
3 SASI_Hs01_00093468 predicted 871
4 SASI_Hs01_00093469 predicted 1067
5 SASI_Hs02_00353276 predicted 1205
6 SASI_Hs01_00093470 predicted 670
7 SASI_Hs02_00353277 predicted 994
8 SASI_Hs01_00093472 predicted 1031
9 SASI_Hs01_00093473 predicted 774
10 SASI_Hs02_00353278 predicted 1275
11 SASI_Hs01_00093471 predicted 917
12 SASI_Hs01_00093474 predicted 1019
13 SASI_Hs01_00093475 predicted 1148
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227005 predicted 1228
2 SASI_Rn02_00227006 predicted 1142
3 SASI_Rn02_00227007 predicted 879
4 SASI_Rn02_00227008 predicted 993
5 SASI_Rn02_00227009 predicted 768
6 SASI_Rn02_00227010 predicted 912
7 SASI_Rn02_00227011 predicted 1186
8 SASI_Rn02_00227012 predicted 970
9 SASI_Rn02_00227013 predicted 977
10 SASI_Rn02_00227014 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00185566 predicted 1198
2 SASI_Rn01_00185567 predicted 940
3 SASI_Rn01_00185568 predicted 1050
4 SASI_Rn01_00185569 predicted 824
5 SASI_Rn01_00185570 predicted 967
6 SASI_Rn01_00185571 predicted 1029
7 SASI_Rn01_00185572 predicted 1027
8 SASI_Rn01_00185573 predicted 927
9 SASI_Rn01_00185574 predicted 431
10 SASI_Rn01_00185575 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327168 predicted 266
2 SASI_Mm02_00327169 predicted 815
3 SASI_Mm02_00327170 predicted 663
4 SASI_Mm02_00327171 predicted 888
5 SASI_Mm02_00327172 predicted 866
6 SASI_Mm02_00327173 predicted 873
7 SASI_Mm02_00327174 predicted 833
8 SASI_Mm02_00327175 predicted 612
9 SASI_Mm02_00327176 predicted 981
10 SASI_Mm02_00327177 predicted 915
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023526
VALIDATED
NKIRAS1 MISSION shRNA Bacterial Glycerol Stock
NFKB inhibitor interacting Ras-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023526.3-804s21c1
Sequence:CCGGTGGCATGAGGTTACGATTTAACTCGAGTTAAATCGTAACCTCATGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023526.3-263s21c1
Sequence:CCGGGAGCAACTCCTTTATGGGAATCTCGAGATTCCCATAAAGGAGTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023526.2-654s1c1
Sequence:CCGGCACTGATTGAACCCTTCACTTCTCGAGAAGTGAAGGGTTCAATCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023526.2-1086s1c1
Sequence:CCGGCCTTCCATAAACGCATGAATACTCGAGTATTCATGCGTTTATGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023526.2-251s1c1
Sequence:CCGGGAGCAACTCCTTTATGGGAATCTCGAGATTCCCATAAAGGAGTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023526.2-412s1c1
Sequence:CCGGCTTCTCATTTGCTGATGGCTTCTCGAGAAGCCATCAGCAAATGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023526.3-666s21c1
Sequence:CCGGCACTGATTGAACCCTTCACTTCTCGAGAAGTGAAGGGTTCAATCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023526.3-496s21c1
Sequence:CCGGTCTGAAGAAAGAGATTGATAACTCGAGTTATCAATCTCTTTCTTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023526.3-447s21c1
Sequence:CCGGTTCTTGTGTATAGTGTGAATACTCGAGTATTCACACTATACACAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023526
VALIDATED
NKIRAS1 MISSION shRNA shRNA Plasmid DNA
NFKB inhibitor interacting Ras-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023526.3-804s21c1
Sequence:CCGGTGGCATGAGGTTACGATTTAACTCGAGTTAAATCGTAACCTCATGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023526.3-263s21c1
Sequence:CCGGGAGCAACTCCTTTATGGGAATCTCGAGATTCCCATAAAGGAGTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023526.2-654s1c1
Sequence:CCGGCACTGATTGAACCCTTCACTTCTCGAGAAGTGAAGGGTTCAATCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023526.2-1086s1c1
Sequence:CCGGCCTTCCATAAACGCATGAATACTCGAGTATTCATGCGTTTATGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023526.2-251s1c1
Sequence:CCGGGAGCAACTCCTTTATGGGAATCTCGAGATTCCCATAAAGGAGTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023526.2-412s1c1
Sequence:CCGGCTTCTCATTTGCTGATGGCTTCTCGAGAAGCCATCAGCAAATGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023526.3-666s21c1
Sequence:CCGGCACTGATTGAACCCTTCACTTCTCGAGAAGTGAAGGGTTCAATCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023526.3-496s21c1
Sequence:CCGGTCTGAAGAAAGAGATTGATAACTCGAGTTATCAATCTCTTTCTTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023526.3-447s21c1
Sequence:CCGGTTCTTGTGTATAGTGTGAATACTCGAGTATTCACACTATACACAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023526
VALIDATED
NKIRAS1 MISSION shRNA Lentiviral Transduction Particles
NFKB inhibitor interacting Ras-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023526.3-804s21c1
Sequence:CCGGTGGCATGAGGTTACGATTTAACTCGAGTTAAATCGTAACCTCATGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023526.3-263s21c1
Sequence:CCGGGAGCAACTCCTTTATGGGAATCTCGAGATTCCCATAAAGGAGTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023526.2-654s1c1
Sequence:CCGGCACTGATTGAACCCTTCACTTCTCGAGAAGTGAAGGGTTCAATCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023526.2-1086s1c1
Sequence:CCGGCCTTCCATAAACGCATGAATACTCGAGTATTCATGCGTTTATGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023526.2-251s1c1
Sequence:CCGGGAGCAACTCCTTTATGGGAATCTCGAGATTCCCATAAAGGAGTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023526.2-412s1c1
Sequence:CCGGCTTCTCATTTGCTGATGGCTTCTCGAGAAGCCATCAGCAAATGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023526.3-666s21c1
Sequence:CCGGCACTGATTGAACCCTTCACTTCTCGAGAAGTGAAGGGTTCAATCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023526.3-496s21c1
Sequence:CCGGTCTGAAGAAAGAGATTGATAACTCGAGTTATCAATCTCTTTCTTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023526.3-447s21c1
Sequence:CCGGTTCTTGTGTATAGTGTGAATACTCGAGTATTCACACTATACACAAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020345
VALIDATED
NKIRAS1 MISSION shRNA Bacterial Glycerol Stock
NFKB inhibitor interacting Ras-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020345.2-752s1c1
Sequence:CCGGCTCTGATTGAACCATTCACTTCTCGAGAAGTGAATGGTTCAATCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020345.2-380s1c1
Sequence:CCGGGAATGGAAGATTGCGAAACAACTCGAGTTGTTTCGCAATCTTCCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020345.2-547s1c1
Sequence:CCGGGTGAATAACCTTGAATCCTTTCTCGAGAAAGGATTCAAGGTTATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020345.2-840s1c1
Sequence:CCGGAGGGAACTCTAATTCTGAGAACTCGAGTTCTCAGAATTAGAGTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020345.2-352s1c1
Sequence:CCGGCAGCTCCTTTATGGAAATCATCTCGAGATGATTTCCATAAAGGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020345.3-1032s21c1
Sequence:CCGGTCTGTGAACATGGAGTAATATCTCGAGATATTACTCCATGTTCACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020345.3-1101s21c1
Sequence:CCGGTTCCTAAGGAAGTCAATTAATCTCGAGATTAATTGACTTCCTTAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020345.3-543s21c1
Sequence:CCGGAGAAACAGACCGAGGAGTAAACTCGAGTTTACTCCTCGGTCTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020345
VALIDATED
NKIRAS1 MISSION shRNA shRNA Plasmid DNA
NFKB inhibitor interacting Ras-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020345.2-752s1c1
Sequence:CCGGCTCTGATTGAACCATTCACTTCTCGAGAAGTGAATGGTTCAATCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020345.2-380s1c1
Sequence:CCGGGAATGGAAGATTGCGAAACAACTCGAGTTGTTTCGCAATCTTCCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020345.2-547s1c1
Sequence:CCGGGTGAATAACCTTGAATCCTTTCTCGAGAAAGGATTCAAGGTTATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020345.2-840s1c1
Sequence:CCGGAGGGAACTCTAATTCTGAGAACTCGAGTTCTCAGAATTAGAGTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020345.2-352s1c1
Sequence:CCGGCAGCTCCTTTATGGAAATCATCTCGAGATGATTTCCATAAAGGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020345.3-1032s21c1
Sequence:CCGGTCTGTGAACATGGAGTAATATCTCGAGATATTACTCCATGTTCACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020345.3-1101s21c1
Sequence:CCGGTTCCTAAGGAAGTCAATTAATCTCGAGATTAATTGACTTCCTTAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020345.3-543s21c1
Sequence:CCGGAGAAACAGACCGAGGAGTAAACTCGAGTTTACTCCTCGGTCTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020345
VALIDATED
NKIRAS1 MISSION shRNA Lentiviral Transduction Particles
NFKB inhibitor interacting Ras-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020345.2-752s1c1
Sequence:CCGGCTCTGATTGAACCATTCACTTCTCGAGAAGTGAATGGTTCAATCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020345.2-380s1c1
Sequence:CCGGGAATGGAAGATTGCGAAACAACTCGAGTTGTTTCGCAATCTTCCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020345.2-547s1c1
Sequence:CCGGGTGAATAACCTTGAATCCTTTCTCGAGAAAGGATTCAAGGTTATTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020345.2-840s1c1
Sequence:CCGGAGGGAACTCTAATTCTGAGAACTCGAGTTCTCAGAATTAGAGTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020345.2-352s1c1
Sequence:CCGGCAGCTCCTTTATGGAAATCATCTCGAGATGATTTCCATAAAGGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020345.3-1032s21c1
Sequence:CCGGTCTGTGAACATGGAGTAATATCTCGAGATATTACTCCATGTTCACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020345.3-1101s21c1
Sequence:CCGGTTCCTAAGGAAGTCAATTAATCTCGAGATTAATTGACTTCCTTAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020345.3-543s21c1
Sequence:CCGGAGAAACAGACCGAGGAGTAAACTCGAGTTTACTCCTCGGTCTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)