EMAIL THIS PAGE TO A FRIEND

NKIRAS2

NFKB inhibitor interacting Ras-like 2

61 Gene Product Result for
Synonyms: KBRAS2 kappaB-Ras2
Gene ID:
Mouse(71966) NFKB inhibitor interacting Ras-like protein 2
Rat(287707) NFKB inhibitor interacting Ras-like 2
Zebrafish(445039) NFKB inhibitor interacting Ras-like 2
chicken(420032) NFKB inhibitor interacting Ras-like 2
cow(509053) NFKB inhibitor interacting Ras-like 2
domestic cat(101093905) NFKB inhibitor interacting Ras-like 2
dog(480518) NFKB inhibitor interacting Ras-like 2
naked mole-rat(101699276) NFKB inhibitor interacting Ras-like 2
domestic guinea pig(100715680) NFKB inhibitor interacting Ras-like 2
sheep(101121275) NFKB inhibitor interacting Ras-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001349 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028024 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028024 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028024 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001349 Rosetta Predictions human pricing
NM_017595 Rosetta Predictions human pricing
NM_001105839 Rosetta Predictions rat pricing
NM_028024 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126084 predicted 957
2 SASI_Hs01_00126085 predicted 1522
3 SASI_Hs01_00126086 predicted 1090
4 SASI_Hs01_00126088 predicted 1269
5 SASI_Hs01_00126089 predicted 1028
6 SASI_Hs01_00126090 predicted 1343
7 SASI_Hs02_00303726 predicted 1097
8 SASI_Hs01_00126091 predicted 863
9 SASI_Hs01_00126092 predicted 1509
10 SASI_Hs02_00303727 predicted 872
11 SASI_Hs01_00126087 predicted 1365
12 SASI_Hs01_00126093 predicted 1492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171079 predicted 477
2 SASI_Hs01_00171080 predicted 1043
3 SASI_Hs01_00171081 predicted 613
4 SASI_Hs01_00171083 predicted 795
5 SASI_Hs01_00171084 predicted 560
6 SASI_Hs01_00171085 predicted 864
7 SASI_Hs02_00350266 predicted 628
8 SASI_Hs01_00171086 predicted 391
9 SASI_Hs01_00171087 predicted 1027
10 SASI_Hs02_00350267 predicted 394
11 SASI_Hs01_00171082 predicted 886
12 SASI_Hs01_00171088 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105839 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213032 predicted 1024
2 SASI_Rn02_00213033 predicted 1125
3 SASI_Rn02_00213034 predicted 1111
4 SASI_Rn02_00213035 predicted 1239
5 SASI_Rn02_00213036 predicted 1188
6 SASI_Rn02_00213037 predicted 1022
7 SASI_Rn02_00213038 predicted 1187
8 SASI_Rn02_00213039 predicted 1137
9 SASI_Rn02_00213040 predicted 753
10 SASI_Rn02_00213041 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028024 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024338 predicted 984
2 SASI_Mm01_00024339 predicted 828
3 SASI_Mm01_00024340 predicted 1054
4 SASI_Mm01_00024341 predicted 625
5 SASI_Mm01_00024342 predicted 979
6 SASI_Mm01_00024343 predicted 807
7 SASI_Mm02_00333161 predicted 1131
8 SASI_Mm01_00024344 predicted 1003
9 SASI_Mm01_00024345 predicted 714
10 SASI_Mm01_00024346 predicted 701
11 SASI_Mm01_00024347 predicted 1106
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001349
NKIRAS2 MISSION shRNA Bacterial Glycerol Stock
NFKB inhibitor interacting Ras-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001349.2-304s21c1
Sequence:CCGGATGGCTACGTCCTGGTCTATACTCGAGTATAGACCAGGACGTAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001349.2-409s21c1
Sequence:CCGGTCGTGGTCCTTGGCAACAAGTCTCGAGACTTGTTGCCAAGGACCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001349.2-1114s21c1
Sequence:CCGGTATGCTCCTATACTGGCATTACTCGAGTAATGCCAGTATAGGAGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001349.2-972s21c1
Sequence:CCGGGGGTCTGAGTTCCTATTATAGCTCGAGCTATAATAGGAACTCAGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001349.1-2294s1c1
Sequence:CCGGCCAGTTCTCTTGATTTCGTAACTCGAGTTACGAAATCAAGAGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001349.1-688s1c1
Sequence:CCGGCAGCTTCTGTATGGGAACCATCTCGAGATGGTTCCCATACAGAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001349.1-913s1c1
Sequence:CCGGGAGCTGCTCAAGAAGGAGATTCTCGAGAATCTCCTTCTTGAGCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001349.1-881s1c1
Sequence:CCGGGCACAGATAGCAGAGAGTCTTCTCGAGAAGACTCTCTGCTATCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001349.1-972s1c1
Sequence:CCGGCCTTGGCAACAAGTGTGACTTCTCGAGAAGTCACACTTGTTGCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001349
NKIRAS2 MISSION shRNA shRNA Plasmid DNA
NFKB inhibitor interacting Ras-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001349.2-304s21c1
Sequence:CCGGATGGCTACGTCCTGGTCTATACTCGAGTATAGACCAGGACGTAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001349.2-409s21c1
Sequence:CCGGTCGTGGTCCTTGGCAACAAGTCTCGAGACTTGTTGCCAAGGACCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001349.2-1114s21c1
Sequence:CCGGTATGCTCCTATACTGGCATTACTCGAGTAATGCCAGTATAGGAGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001349.2-972s21c1
Sequence:CCGGGGGTCTGAGTTCCTATTATAGCTCGAGCTATAATAGGAACTCAGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001349.1-2294s1c1
Sequence:CCGGCCAGTTCTCTTGATTTCGTAACTCGAGTTACGAAATCAAGAGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001349.1-688s1c1
Sequence:CCGGCAGCTTCTGTATGGGAACCATCTCGAGATGGTTCCCATACAGAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001349.1-913s1c1
Sequence:CCGGGAGCTGCTCAAGAAGGAGATTCTCGAGAATCTCCTTCTTGAGCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001349.1-881s1c1
Sequence:CCGGGCACAGATAGCAGAGAGTCTTCTCGAGAAGACTCTCTGCTATCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001349.1-972s1c1
Sequence:CCGGCCTTGGCAACAAGTGTGACTTCTCGAGAAGTCACACTTGTTGCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001349
NKIRAS2 MISSION shRNA Lentiviral Transduction Particles
NFKB inhibitor interacting Ras-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001349.2-304s21c1
Sequence:CCGGATGGCTACGTCCTGGTCTATACTCGAGTATAGACCAGGACGTAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001349.2-409s21c1
Sequence:CCGGTCGTGGTCCTTGGCAACAAGTCTCGAGACTTGTTGCCAAGGACCACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001349.2-1114s21c1
Sequence:CCGGTATGCTCCTATACTGGCATTACTCGAGTAATGCCAGTATAGGAGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001349.2-972s21c1
Sequence:CCGGGGGTCTGAGTTCCTATTATAGCTCGAGCTATAATAGGAACTCAGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001349.1-2294s1c1
Sequence:CCGGCCAGTTCTCTTGATTTCGTAACTCGAGTTACGAAATCAAGAGAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001349.1-688s1c1
Sequence:CCGGCAGCTTCTGTATGGGAACCATCTCGAGATGGTTCCCATACAGAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001349.1-913s1c1
Sequence:CCGGGAGCTGCTCAAGAAGGAGATTCTCGAGAATCTCCTTCTTGAGCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001349.1-881s1c1
Sequence:CCGGGCACAGATAGCAGAGAGTCTTCTCGAGAAGACTCTCTGCTATCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001349.1-972s1c1
Sequence:CCGGCCTTGGCAACAAGTGTGACTTCTCGAGAAGTCACACTTGTTGCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028024
VALIDATED
NKIRAS2 MISSION shRNA Bacterial Glycerol Stock
NFKB inhibitor interacting Ras-like 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028024.2-377s21c1
Sequence:CCGGGATCGACAAGTCCAAGGACAACTCGAGTTGTCCTTGGACTTGTCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028024.2-155s21c1
Sequence:CCGGTGTCGTGGGTTCTGAGATGATCTCGAGATCATCTCAGAACCCACGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028024.2-783s21c1
Sequence:CCGGGCCACCTTTGTCCTCTCTTAACTCGAGTTAAGAGAGGACAAAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028024.2-487s21c1
Sequence:CCGGAGTCCGAGAAGGTGAAGCTATCTCGAGATAGCTTCACCTTCTCGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028024.1-783s1c1
Sequence:CCGGGCCACCTTTGTCCTCTCTTAACTCGAGTTAAGAGAGGACAAAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028024.1-377s1c1
Sequence:CCGGGATCGACAAGTCCAAGGACAACTCGAGTTGTCCTTGGACTTGTCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028024.1-155s1c1
Sequence:CCGGTGTCGTGGGTTCTGAGATGATCTCGAGATCATCTCAGAACCCACGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028024.1-380s1c1
Sequence:CCGGCGACAAGTCCAAGGACAAGAACTCGAGTTCTTGTCCTTGGACTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028024.1-487s1c1
Sequence:CCGGAGTCCGAGAAGGTGAAGCTATCTCGAGATAGCTTCACCTTCTCGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028024
VALIDATED
NKIRAS2 MISSION shRNA shRNA Plasmid DNA
NFKB inhibitor interacting Ras-like 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028024.2-377s21c1
Sequence:CCGGGATCGACAAGTCCAAGGACAACTCGAGTTGTCCTTGGACTTGTCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028024.2-155s21c1
Sequence:CCGGTGTCGTGGGTTCTGAGATGATCTCGAGATCATCTCAGAACCCACGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028024.2-783s21c1
Sequence:CCGGGCCACCTTTGTCCTCTCTTAACTCGAGTTAAGAGAGGACAAAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028024.2-487s21c1
Sequence:CCGGAGTCCGAGAAGGTGAAGCTATCTCGAGATAGCTTCACCTTCTCGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028024.1-783s1c1
Sequence:CCGGGCCACCTTTGTCCTCTCTTAACTCGAGTTAAGAGAGGACAAAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028024.1-377s1c1
Sequence:CCGGGATCGACAAGTCCAAGGACAACTCGAGTTGTCCTTGGACTTGTCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028024.1-155s1c1
Sequence:CCGGTGTCGTGGGTTCTGAGATGATCTCGAGATCATCTCAGAACCCACGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028024.1-380s1c1
Sequence:CCGGCGACAAGTCCAAGGACAAGAACTCGAGTTCTTGTCCTTGGACTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028024.1-487s1c1
Sequence:CCGGAGTCCGAGAAGGTGAAGCTATCTCGAGATAGCTTCACCTTCTCGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028024
VALIDATED
NKIRAS2 MISSION shRNA Lentiviral Transduction Particles
NFKB inhibitor interacting Ras-like 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028024.2-377s21c1
Sequence:CCGGGATCGACAAGTCCAAGGACAACTCGAGTTGTCCTTGGACTTGTCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028024.2-155s21c1
Sequence:CCGGTGTCGTGGGTTCTGAGATGATCTCGAGATCATCTCAGAACCCACGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028024.2-783s21c1
Sequence:CCGGGCCACCTTTGTCCTCTCTTAACTCGAGTTAAGAGAGGACAAAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028024.2-487s21c1
Sequence:CCGGAGTCCGAGAAGGTGAAGCTATCTCGAGATAGCTTCACCTTCTCGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028024.1-783s1c1
Sequence:CCGGGCCACCTTTGTCCTCTCTTAACTCGAGTTAAGAGAGGACAAAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028024.1-377s1c1
Sequence:CCGGGATCGACAAGTCCAAGGACAACTCGAGTTGTCCTTGGACTTGTCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028024.1-155s1c1
Sequence:CCGGTGTCGTGGGTTCTGAGATGATCTCGAGATCATCTCAGAACCCACGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028024.1-380s1c1
Sequence:CCGGCGACAAGTCCAAGGACAAGAACTCGAGTTCTTGTCCTTGGACTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028024.1-487s1c1
Sequence:CCGGAGTCCGAGAAGGTGAAGCTATCTCGAGATAGCTTCACCTTCTCGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)