EMAIL THIS PAGE TO A FRIEND

NKRF

NFKB repressing factor

122 Gene Product Result for
Synonyms: ITBA4 NRF
UniProtKB ID: O15226, G3V1N1, Q4VC41, Q9UJ91
Gene ID:
Human(55922) Summary: This gene encodes a transcriptional repressor that interacts with specific negative regulatory elements to mediate transcriptional repression of certain nuclear factor kappa B responsive genes. The protein localizes predominantly to the nucleolus with a small fraction found in the nucleoplasm and cytoplasm. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Mouse(77286) NF-kappaB repressing factor
Rat(298316) NFKB repressing factor
domestic guinea pig(100727485) NFKB repressing factor
naked mole-rat(101698502) NFKB repressing factor
Domestic Rabbit(100355080) NFKB repressing factor
sheep(101103298) NFKB repressing factor
Zebrafish(797627) NF-kappa B repressing factor
chicken(422370) NFKB repressing factor
domestic cat(101083574) NFKB repressing factor
cow(100124519) NFKB repressing factor
Horse(100058988) NFKB repressing factor
dog(100684319) NFKB repressing factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
T4376 N-p-Tosyl-L-phenylalanine chloromethyl ketone ≥97% (TLC), powder human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
E7881 Emodin from Frangula bark, ≥90% (HPLC) human pricing
P0667 Parthenolide ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017544 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017544 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017544 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029891 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029891 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029891 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017544 Rosetta Predictions human pricing
XM_233308 Rosetta Predictions rat pricing
NM_029891 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106329 predicted 414
2 SASI_Hs01_00106330 predicted 1237
3 SASI_Hs02_00350173 predicted 480
4 SASI_Hs01_00106331 predicted 431
5 SASI_Hs01_00106332 predicted 954
6 SASI_Hs01_00106334 predicted 758
7 SASI_Hs01_00106335 predicted 1242
8 SASI_Hs01_00106336 predicted 358
9 SASI_Hs01_00106337 predicted 2062
10 SASI_Hs02_00350174 predicted 1177
11 SASI_Hs01_00106328 predicted 679
12 SASI_Hs01_00106333 predicted 2297
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387642 predicted 2052
2 SASI_Rn02_00387643 predicted 2421
3 SASI_Rn02_00387644 predicted 2170
4 SASI_Rn02_00387645 predicted 1426
5 SASI_Rn02_00387646 predicted 1637
6 SASI_Rn02_00387647 predicted 987
7 SASI_Rn02_00387648 predicted 2380
8 SASI_Rn02_00387649 predicted 2197
9 SASI_Rn02_00387650 predicted 2386
10 SASI_Rn02_00387651 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199003 predicted 457
2 SASI_Mm01_00199004 predicted 791
3 SASI_Mm01_00199005 predicted 894
4 SASI_Mm01_00199007 predicted 725
5 SASI_Mm01_00199008 predicted 1069
6 SASI_Mm01_00199009 predicted 1117
7 SASI_Mm01_00199010 predicted 1988
8 SASI_Mm01_00199011 predicted 1222
9 SASI_Mm01_00199012 predicted 1208
10 SASI_Mm02_00336141 predicted 2003
11 SASI_Mm01_00199006 predicted 1499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017544
VALIDATED
NKRF MISSION shRNA Bacterial Glycerol Stock
NFKB repressing factor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017544.2-1501s21c1
Sequence:CCGGGAACGACACAGCTCAGTTTAACTCGAGTTAAACTGAGCTGTGTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017544.2-1915s21c1
Sequence:CCGGGGATGTAGAGAGGGTGAATAACTCGAGTTATTCACCCTCTCTACATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017544.2-2486s21c1
Sequence:CCGGTACCCTGAGAAATTATCATTTCTCGAGAAATGATAATTTCTCAGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017544.2-749s21c1
Sequence:CCGGCGTTGTATTCAGGCGTGTAAGCTCGAGCTTACACGCCTGAATACAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017544.1-1505s1c1
Sequence:CCGGGCGGAAATTCAAGCATACATTCTCGAGAATGTATGCTTGAATTTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017544.1-1374s1c1
Sequence:CCGGGCTTGTGAAGTTAGATGCCAACTCGAGTTGGCATCTAACTTCACAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_017544.1-1118s1c1
Sequence:CCGGGCCTTCACCATCACAGACATTCTCGAGAATGTCTGTGATGGTGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017544.1-930s1c1
Sequence:CCGGCCAAGAGACATCTACCAAGATCTCGAGATCTTGGTAGATGTCTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017544.1-1709s1c1
Sequence:CCGGCCTTAACAATTCTGCCTCATTCTCGAGAATGAGGCAGAATTGTTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017544.2-1177s21c1
Sequence:CCGGTGATGCAATTGGTATCCTTAACTCGAGTTAAGGATACCAATTGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017544
VALIDATED
NKRF MISSION shRNA shRNA Plasmid DNA
NFKB repressing factor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017544.2-1501s21c1
Sequence:CCGGGAACGACACAGCTCAGTTTAACTCGAGTTAAACTGAGCTGTGTCGTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000244908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017544.2-1915s21c1
Sequence:CCGGGGATGTAGAGAGGGTGAATAACTCGAGTTATTCACCCTCTCTACATCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000244909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017544.2-2486s21c1
Sequence:CCGGTACCCTGAGAAATTATCATTTCTCGAGAAATGATAATTTCTCAGGGTATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000244905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017544.2-749s21c1
Sequence:CCGGCGTTGTATTCAGGCGTGTAAGCTCGAGCTTACACGCCTGAATACAACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000016428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017544.1-1505s1c1
Sequence:CCGGGCGGAAATTCAAGCATACATTCTCGAGAATGTATGCTTGAATTTCCGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000016429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017544.1-1374s1c1
Sequence:CCGGGCTTGTGAAGTTAGATGCCAACTCGAGTTGGCATCTAACTTCACAAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000016431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_017544.1-1118s1c1
Sequence:CCGGGCCTTCACCATCACAGACATTCTCGAGAATGTCTGTGATGGTGAAGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000016432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017544.1-930s1c1
Sequence:CCGGCCAAGAGACATCTACCAAGATCTCGAGATCTTGGTAGATGTCTCTTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000016430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017544.1-1709s1c1
Sequence:CCGGCCTTAACAATTCTGCCTCATTCTCGAGAATGAGGCAGAATTGTTAAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000244906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017544.2-1177s21c1
Sequence:CCGGTGATGCAATTGGTATCCTTAACTCGAGTTAAGGATACCAATTGCATCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017544
VALIDATED
NKRF MISSION shRNA Lentiviral Transduction Particles
NFKB repressing factor
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000244907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017544.2-1501s21c1
Sequence:CCGGGAACGACACAGCTCAGTTTAACTCGAGTTAAACTGAGCTGTGTCGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017544.2-1915s21c1
Sequence:CCGGGGATGTAGAGAGGGTGAATAACTCGAGTTATTCACCCTCTCTACATCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017544.2-2486s21c1
Sequence:CCGGTACCCTGAGAAATTATCATTTCTCGAGAAATGATAATTTCTCAGGGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017544.2-749s21c1
Sequence:CCGGCGTTGTATTCAGGCGTGTAAGCTCGAGCTTACACGCCTGAATACAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017544.1-1505s1c1
Sequence:CCGGGCGGAAATTCAAGCATACATTCTCGAGAATGTATGCTTGAATTTCCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017544.1-1374s1c1
Sequence:CCGGGCTTGTGAAGTTAGATGCCAACTCGAGTTGGCATCTAACTTCACAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_017544.1-1118s1c1
Sequence:CCGGGCCTTCACCATCACAGACATTCTCGAGAATGTCTGTGATGGTGAAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017544.1-930s1c1
Sequence:CCGGCCAAGAGACATCTACCAAGATCTCGAGATCTTGGTAGATGTCTCTTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017544.1-1709s1c1
Sequence:CCGGCCTTAACAATTCTGCCTCATTCTCGAGAATGAGGCAGAATTGTTAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017544.2-1177s21c1
Sequence:CCGGTGATGCAATTGGTATCCTTAACTCGAGTTAAGGATACCAATTGCATCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029891
VALIDATED
NKRF MISSION shRNA Bacterial Glycerol Stock
NFKB repressing factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029891.2-1030s1c1
Sequence:CCGGCGACGGAAATTCAAGCACATACTCGAGTATGTGCTTGAATTTCCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029891.2-2805s1c1
Sequence:CCGGCCCTGTGATTTCCAGGATATTCTCGAGAATATCCTGGAAATCACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029891.2-1574s1c1
Sequence:CCGGCGGTTGAATATGTCTATGAAACTCGAGTTTCATAGACATATTCAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029891.2-2077s1c1
Sequence:CCGGCGGAAGCAAATCCATCAGATTCTCGAGAATCTGATGGATTTGCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029891.2-2173s1c1
Sequence:CCGGCGGAAGGAAGACCTACTAGATCTCGAGATCTAGTAGGTCTTCCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029891
VALIDATED
NKRF MISSION shRNA shRNA Plasmid DNA
NFKB repressing factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029891.2-1030s1c1
Sequence:CCGGCGACGGAAATTCAAGCACATACTCGAGTATGTGCTTGAATTTCCGTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000123964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029891.2-2805s1c1
Sequence:CCGGCCCTGTGATTTCCAGGATATTCTCGAGAATATCCTGGAAATCACAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000123965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029891.2-1574s1c1
Sequence:CCGGCGGTTGAATATGTCTATGAAACTCGAGTTTCATAGACATATTCAACCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000123968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029891.2-2077s1c1
Sequence:CCGGCGGAAGCAAATCCATCAGATTCTCGAGAATCTGATGGATTTGCTTCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000123966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029891.2-2173s1c1
Sequence:CCGGCGGAAGGAAGACCTACTAGATCTCGAGATCTAGTAGGTCTTCCTTCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029891
VALIDATED
NKRF MISSION shRNA Lentiviral Transduction Particles
NFKB repressing factor
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000123967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029891.2-1030s1c1
Sequence:CCGGCGACGGAAATTCAAGCACATACTCGAGTATGTGCTTGAATTTCCGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029891.2-2805s1c1
Sequence:CCGGCCCTGTGATTTCCAGGATATTCTCGAGAATATCCTGGAAATCACAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029891.2-1574s1c1
Sequence:CCGGCGGTTGAATATGTCTATGAAACTCGAGTTTCATAGACATATTCAACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029891.2-2077s1c1
Sequence:CCGGCGGAAGCAAATCCATCAGATTCTCGAGAATCTGATGGATTTGCTTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029891.2-2173s1c1
Sequence:CCGGCGGAAGGAAGACCTACTAGATCTCGAGATCTAGTAGGTCTTCCTTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)