EMAIL THIS PAGE TO A FRIEND

NKX1-1

NK1 homeobox 1

64 Gene Product Result for
Synonyms: HSPX153 NKX-1.1 SAX2
UniProtKB ID: Q15270
Gene ID:
Mouse(672284) NK1 transcription factor related, locus 1 (Drosophila)
Rat(298981) NK1 homeobox 1
naked mole-rat(101717525) NK1 homeobox 1
chicken(771636) NK1 homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001473635 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001473635 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001473635 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_373009 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_373009 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_373009 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715809 Rosetta Predictions human pricing
XM_926341 Rosetta Predictions human pricing
XM_937659 Rosetta Predictions human pricing
XM_001065657 Rosetta Predictions rat pricing
XM_234082 Rosetta Predictions rat pricing
XM_001473635 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00406259 predicted 1764
2 SASI_Hs02_00406260 predicted 1427
3 SASI_Hs02_00406261 predicted 1199
4 SASI_Hs02_00406262 predicted 1765
5 SASI_Hs02_00406263 predicted 1494
6 SASI_Hs02_00406264 predicted 1528
7 SASI_Hs02_00406265 predicted 240
8 SASI_Hs02_00406266 predicted 1070
9 SASI_Hs02_00406267 predicted 1068
10 SASI_Hs02_00406268 predicted 1779
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480354 predicted 3324
2 SASI_Hs02_00480355 predicted 3776
3 SASI_Hs01_00258459 predicted 695
4 SASI_Hs01_00258460 predicted 228
5 SASI_Hs01_00258461 predicted 252
6 SASI_Hs01_00258462 predicted 570
7 SASI_Hs01_00258463 predicted 453
8 SASI_Hs01_00258464 predicted 210
9 SASI_Hs01_00258465 predicted 575
10 SASI_Hs01_00258466 predicted 577
11 SASI_Hs01_00258467 predicted 393
12 SASI_Hs01_00258468 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482686 predicted 1303
2 SASI_Hs02_00482687 predicted 1181
3 SASI_Hs02_00482688 predicted 627
4 SASI_Hs02_00482689 predicted 1208
5 SASI_Hs02_00482690 predicted 1001
6 SASI_Hs02_00482691 predicted 980
7 SASI_Hs02_00482692 predicted 1297
8 SASI_Hs02_00482693 predicted 1079
9 SASI_Hs02_00482694 predicted 951
10 SASI_Hs02_00482695 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314948 predicted 448
2 SASI_Rn02_00314949 predicted 450
3 SASI_Rn02_00314950 predicted 254
4 SASI_Rn02_00314951 predicted 837
5 SASI_Rn02_00314952 predicted 441
6 SASI_Rn02_00314953 predicted 596
7 SASI_Rn02_00314954 predicted 549
8 SASI_Rn02_00314955 predicted 385
9 SASI_Rn02_00314956 predicted 276
10 SASI_Rn02_00314957 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388264 predicted 422
2 SASI_Rn02_00388265 predicted 498
3 SASI_Rn02_00388266 predicted 262
4 SASI_Rn02_00388267 predicted 213
5 SASI_Rn02_00388268 predicted 472
6 SASI_Rn02_00388269 predicted 479
7 SASI_Rn02_00388270 predicted 203
8 SASI_Rn02_00388271 predicted 328
9 SASI_Rn02_00388272 predicted 321
10 SASI_Rn02_00388273 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00369520 predicted 638
2 SASI_Mm02_00369521 predicted 324
3 SASI_Mm02_00369522 predicted 710
4 SASI_Mm02_00369523 predicted 624
5 SASI_Mm02_00369524 predicted 326
6 SASI_Mm02_00369525 predicted 328
7 SASI_Mm02_00369526 predicted 373
8 SASI_Mm02_00369527 predicted 626
9 SASI_Mm02_00369528 predicted 695
10 SASI_Mm02_00369529 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001473635
NKX1-1 MISSION shRNA Bacterial Glycerol Stock
NK1 homeobox 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473635.1-874s21c1
Sequence:CCGGACGCAGGTGAAGATCTGGTTCCTCGAGGAACCAGATCTTCACCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473635.1-161s21c1
Sequence:CCGGACAAGTTCAACAGTAGGAGACCTCGAGGTCTCCTACTGTTGAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473635.1-788s21c1
Sequence:CCGGTGGCGCTGGAGAACAAGTTTACTCGAGTAAACTTGTTCTCCAGCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473635.1-150s21c1
Sequence:CCGGCCTAGATCCCAACAAGTTCAACTCGAGTTGAACTTGTTGGGATCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473635.1-136s21c1
Sequence:CCGGTCCGTGTTGGACATCCTAGATCTCGAGATCTAGGATGTCCAACACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001473635
NKX1-1 MISSION shRNA shRNA Plasmid DNA
NK1 homeobox 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473635.1-874s21c1
Sequence:CCGGACGCAGGTGAAGATCTGGTTCCTCGAGGAACCAGATCTTCACCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473635.1-161s21c1
Sequence:CCGGACAAGTTCAACAGTAGGAGACCTCGAGGTCTCCTACTGTTGAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473635.1-788s21c1
Sequence:CCGGTGGCGCTGGAGAACAAGTTTACTCGAGTAAACTTGTTCTCCAGCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473635.1-150s21c1
Sequence:CCGGCCTAGATCCCAACAAGTTCAACTCGAGTTGAACTTGTTGGGATCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473635.1-136s21c1
Sequence:CCGGTCCGTGTTGGACATCCTAGATCTCGAGATCTAGGATGTCCAACACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001473635
NKX1-1 MISSION shRNA Lentiviral Transduction Particles
NK1 homeobox 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473635.1-874s21c1
Sequence:CCGGACGCAGGTGAAGATCTGGTTCCTCGAGGAACCAGATCTTCACCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473635.1-161s21c1
Sequence:CCGGACAAGTTCAACAGTAGGAGACCTCGAGGTCTCCTACTGTTGAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473635.1-788s21c1
Sequence:CCGGTGGCGCTGGAGAACAAGTTTACTCGAGTAAACTTGTTCTCCAGCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473635.1-150s21c1
Sequence:CCGGCCTAGATCCCAACAAGTTCAACTCGAGTTGAACTTGTTGGGATCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473635.1-136s21c1
Sequence:CCGGTCCGTGTTGGACATCCTAGATCTCGAGATCTAGGATGTCCAACACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_373009
NKX1-1 MISSION shRNA Bacterial Glycerol Stock
NK1 homeobox 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373009.1-219s1c1
Sequence:CCGGGTCCGACTCCAAGTCCGGGAACTCGAGTTCCCGGACTTGGAGTCGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373009.1-390s1c1
Sequence:CCGGGAACCGCCGAACCAACCCGCTCTCGAGAGCGGGTTGGTTCGGCGGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373009.1-309s1c1
Sequence:CCGGGCGCTACCTGTCGGTGTGCGACTCGAGTCGCACACCGACAGGTAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373009.1-345s1c1
Sequence:CCGGGCTGTCGCTCAGCCTCACCGACTCGAGTCGGTGAGGCTGAGCGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373009.1-287s1c1
Sequence:CCGGTGGAGAACAAGTTCAAGGCCACTCGAGTGGCCTTGAACTTGTTCTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_373009
NKX1-1 MISSION shRNA shRNA Plasmid DNA
NK1 homeobox 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373009.1-219s1c1
Sequence:CCGGGTCCGACTCCAAGTCCGGGAACTCGAGTTCCCGGACTTGGAGTCGGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373009.1-390s1c1
Sequence:CCGGGAACCGCCGAACCAACCCGCTCTCGAGAGCGGGTTGGTTCGGCGGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373009.1-309s1c1
Sequence:CCGGGCGCTACCTGTCGGTGTGCGACTCGAGTCGCACACCGACAGGTAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373009.1-345s1c1
Sequence:CCGGGCTGTCGCTCAGCCTCACCGACTCGAGTCGGTGAGGCTGAGCGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373009.1-287s1c1
Sequence:CCGGTGGAGAACAAGTTCAAGGCCACTCGAGTGGCCTTGAACTTGTTCTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_373009
NKX1-1 MISSION shRNA Lentiviral Transduction Particles
NK1 homeobox 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373009.1-219s1c1
Sequence:CCGGGTCCGACTCCAAGTCCGGGAACTCGAGTTCCCGGACTTGGAGTCGGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373009.1-390s1c1
Sequence:CCGGGAACCGCCGAACCAACCCGCTCTCGAGAGCGGGTTGGTTCGGCGGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373009.1-309s1c1
Sequence:CCGGGCGCTACCTGTCGGTGTGCGACTCGAGTCGCACACCGACAGGTAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373009.1-345s1c1
Sequence:CCGGGCTGTCGCTCAGCCTCACCGACTCGAGTCGGTGAGGCTGAGCGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373009.1-287s1c1
Sequence:CCGGTGGAGAACAAGTTCAAGGCCACTCGAGTGGCCTTGAACTTGTTCTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)