EMAIL THIS PAGE TO A FRIEND

NKX2-1

NK2 homeobox 1

87 Gene Product Result for
Synonyms: BCH BHC NK-2 NKX2.1 NKX2A TEBP TITF1 TTF-1 TTF1
UniProtKB ID: P43699, D3DSA3, O14954, O14955, Q7KZF6, Q9BRJ8
Gene ID:
Human(7080) Summary: This gene encodes a protein initially identified as a thyroid-specific transcription factor. The encoded protein binds to the thyroglobulin promoter and regulates the expression of thyroid-specific genes but has also been shown to regulate the expression of genes involved in morphogenesis. Mutations and deletions in this gene are associated with benign hereditary chorea, choreoathetosis, congenital hypothyroidism, and neonatal respiratory distress, and may be associated with thyroid cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares the symbol/alias 'TFF1' with another gene, transcription termination factor 1, which plays a role in ribosomal gene transcription. [provided by RefSeq, Apr 2011]
Mouse(21869) NK2 homeobox 1
Rat(25628) NK2 homeobox 1
chicken(395322) NK2 homeobox 1
dog(403940) NK2 homeobox 1
domestic cat(101091876) NK2 homeobox 1
naked mole-rat(101703474) NK2 homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003317 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079668 Rosetta Predictions human pricing
NM_003317 Rosetta Predictions human pricing
XM_001079296 Rosetta Predictions rat pricing
XM_216720 Rosetta Predictions rat pricing
NM_009385 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313620 predicted 557
2 SASI_Hs02_00313621 predicted 352
3 SASI_Hs02_00313622 predicted 461
4 SASI_Hs02_00313623 predicted 553
5 SASI_Hs02_00313624 predicted 358
6 SASI_Hs02_00313625 predicted 456
7 SASI_Hs02_00313626 predicted 554
8 SASI_Hs02_00313627 predicted 564
9 SASI_Hs02_00313628 predicted 428
10 SASI_Hs02_00313629 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189848 predicted 728
2 SASI_Hs01_00189849 predicted 526
3 SASI_Hs01_00189850 predicted 627
4 SASI_Hs01_00189851 predicted 727
5 SASI_Hs01_00189852 predicted 521
6 SASI_Hs01_00189853 predicted 630
7 SASI_Hs01_00189854 predicted 724
8 SASI_Hs01_00189855 predicted 731
9 SASI_Hs01_00189856 predicted 594
10 SASI_Hs01_00189857 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363860 predicted 1028
2 SASI_Rn02_00363861 predicted 1029
3 SASI_Rn02_00363862 predicted 843
4 SASI_Rn02_00363863 predicted 25
5 SASI_Rn02_00363864 predicted 1078
6 SASI_Rn02_00363865 predicted 571
7 SASI_Rn02_00363866 predicted 1159
8 SASI_Rn02_00363867 predicted 637
9 SASI_Rn02_00363868 predicted 1076
10 SASI_Rn02_00363869 predicted 18
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376767 predicted 387
2 SASI_Rn02_00376768 predicted 1023
3 SASI_Rn02_00376769 predicted 384
4 SASI_Rn02_00376770 predicted 389
5 SASI_Rn02_00376771 predicted 255
6 SASI_Rn02_00376772 predicted 1029
7 SASI_Rn02_00376773 predicted 383
8 SASI_Rn02_00376774 predicted 384
9 SASI_Rn02_00376775 predicted 1012
10 SASI_Rn02_00376776 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048633 predicted 640
2 SASI_Mm01_00048634 predicted 645
3 SASI_Mm01_00048635 predicted 640
4 SASI_Mm01_00048636 predicted 1648
5 SASI_Mm01_00048637 predicted 633
6 SASI_Mm01_00048638 predicted 903
7 SASI_Mm01_00048639 predicted 1835
8 SASI_Mm01_00048640 predicted 2179
9 SASI_Mm01_00048641 predicted 1144
10 SASI_Mm01_00048642 predicted 1679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003317
NKX2-1 MISSION shRNA Bacterial Glycerol Stock
NK2 homeobox 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003317.3-1699s21c1
Sequence:CCGGTCCAATCTCAAGGAATCTTTACTCGAGTAAAGATTCCTTGAGATTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003317.3-872s21c1
Sequence:CCGGGCGACGCTTCAAGCAACAGAACTCGAGTTCTGTTGCTTGAAGCGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003317.3-1821s21c1
Sequence:CCGGGACATGGCTCTGGACTCTAAACTCGAGTTTAGAGTCCAGAGCCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003317.3-740s1c1
Sequence:CCGGCGGCATGAACATGAGCGGCATCTCGAGATGCCGCTCATGTTCATGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003317.3-1609s21c1
Sequence:CCGGCCAAACTGCTGGACGTCTTTCCTCGAGGAAAGACGTCCAGCAGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003317.3-1432s1c1
Sequence:CCGGCCTTGCTATACGGTCGGACCTCTCGAGAGGTCCGACCGTATAGCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003317.3-368s1c1
Sequence:CCGGTCCGTTCTCAGTGTCTGACATCTCGAGATGTCAGACACTGAGAACGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003317.3-398s1c1
Sequence:CCGGCCTGGAGGAAAGCTACAAGAACTCGAGTTCTTGTAGCTTTCCTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003317
NKX2-1 MISSION shRNA shRNA Plasmid DNA
NK2 homeobox 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003317.3-1699s21c1
Sequence:CCGGTCCAATCTCAAGGAATCTTTACTCGAGTAAAGATTCCTTGAGATTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003317.3-872s21c1
Sequence:CCGGGCGACGCTTCAAGCAACAGAACTCGAGTTCTGTTGCTTGAAGCGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003317.3-1821s21c1
Sequence:CCGGGACATGGCTCTGGACTCTAAACTCGAGTTTAGAGTCCAGAGCCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003317.3-740s1c1
Sequence:CCGGCGGCATGAACATGAGCGGCATCTCGAGATGCCGCTCATGTTCATGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003317.3-1609s21c1
Sequence:CCGGCCAAACTGCTGGACGTCTTTCCTCGAGGAAAGACGTCCAGCAGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003317.3-1432s1c1
Sequence:CCGGCCTTGCTATACGGTCGGACCTCTCGAGAGGTCCGACCGTATAGCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003317.3-368s1c1
Sequence:CCGGTCCGTTCTCAGTGTCTGACATCTCGAGATGTCAGACACTGAGAACGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003317.3-398s1c1
Sequence:CCGGCCTGGAGGAAAGCTACAAGAACTCGAGTTCTTGTAGCTTTCCTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003317
NKX2-1 MISSION shRNA Lentiviral Transduction Particles
NK2 homeobox 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003317.3-1699s21c1
Sequence:CCGGTCCAATCTCAAGGAATCTTTACTCGAGTAAAGATTCCTTGAGATTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003317.3-872s21c1
Sequence:CCGGGCGACGCTTCAAGCAACAGAACTCGAGTTCTGTTGCTTGAAGCGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003317.3-1821s21c1
Sequence:CCGGGACATGGCTCTGGACTCTAAACTCGAGTTTAGAGTCCAGAGCCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003317.3-740s1c1
Sequence:CCGGCGGCATGAACATGAGCGGCATCTCGAGATGCCGCTCATGTTCATGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003317.3-1609s21c1
Sequence:CCGGCCAAACTGCTGGACGTCTTTCCTCGAGGAAAGACGTCCAGCAGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003317.3-1432s1c1
Sequence:CCGGCCTTGCTATACGGTCGGACCTCTCGAGAGGTCCGACCGTATAGCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003317.3-368s1c1
Sequence:CCGGTCCGTTCTCAGTGTCTGACATCTCGAGATGTCAGACACTGAGAACGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003317.3-398s1c1
Sequence:CCGGCCTGGAGGAAAGCTACAAGAACTCGAGTTCTTGTAGCTTTCCTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009385
NKX2-1 MISSION shRNA Bacterial Glycerol Stock
NK2 homeobox 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009385.2-2164s1c1
Sequence:CCGGGCCAAGCAAATTCAACCCTTTCTCGAGAAAGGGTTGAATTTGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009385.2-1144s1c1
Sequence:CCGGGCGACGTTTCAAGCAACAGAACTCGAGTTCTGTTGCTTGAAACGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009385.2-1012s1c1
Sequence:CCGGCGGCATGAATATGAGTGGCATCTCGAGATGCCACTCATATTCATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009385.2-1690s1c1
Sequence:CCGGCGCCATGTCTTGTTCTACCTTCTCGAGAAGGTAGAACAAGACATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009385.2-643s1c1
Sequence:CCGGGTTCTCAGTGTCTGACATCTTCTCGAGAAGATGTCAGACACTGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009385
NKX2-1 MISSION shRNA shRNA Plasmid DNA
NK2 homeobox 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009385.2-2164s1c1
Sequence:CCGGGCCAAGCAAATTCAACCCTTTCTCGAGAAAGGGTTGAATTTGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009385.2-1144s1c1
Sequence:CCGGGCGACGTTTCAAGCAACAGAACTCGAGTTCTGTTGCTTGAAACGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009385.2-1012s1c1
Sequence:CCGGCGGCATGAATATGAGTGGCATCTCGAGATGCCACTCATATTCATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009385.2-1690s1c1
Sequence:CCGGCGCCATGTCTTGTTCTACCTTCTCGAGAAGGTAGAACAAGACATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009385.2-643s1c1
Sequence:CCGGGTTCTCAGTGTCTGACATCTTCTCGAGAAGATGTCAGACACTGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009385
NKX2-1 MISSION shRNA Lentiviral Transduction Particles
NK2 homeobox 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009385.2-2164s1c1
Sequence:CCGGGCCAAGCAAATTCAACCCTTTCTCGAGAAAGGGTTGAATTTGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009385.2-1144s1c1
Sequence:CCGGGCGACGTTTCAAGCAACAGAACTCGAGTTCTGTTGCTTGAAACGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009385.2-1012s1c1
Sequence:CCGGCGGCATGAATATGAGTGGCATCTCGAGATGCCACTCATATTCATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009385.2-1690s1c1
Sequence:CCGGCGCCATGTCTTGTTCTACCTTCTCGAGAAGGTAGAACAAGACATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009385.2-643s1c1
Sequence:CCGGGTTCTCAGTGTCTGACATCTTCTCGAGAAGATGTCAGACACTGAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)