EMAIL THIS PAGE TO A FRIEND

NKX2-2

NK2 homeobox 2

81 Gene Product Result for
Synonyms: NKX2.2 NKX2B
UniProtKB ID: O95096
Gene ID:
Human(4821) Summary: The protein encoded by this gene contains a homeobox domain and may be involved in the morphogenesis of the central nervous system. This gene is found on chromosome 20 near NKX2-4, and these two genes appear to be duplicated on chromosome 14 in the form of TITF1 and NKX2-8. The encoded protein is likely to be a nuclear transcription factor. [provided by RefSeq, Jul 2008]
Mouse(18088) NK2 homeobox 2
Rat(366214) NK2 homeobox 2
chicken(428549) NK2 homeobox 2
dog(485744) NK2 homeobox 2
domestic cat(101083926) NK2 homeobox 2
cow(531695) NK2 homeobox 2
sheep(101102505) NK2 homeobox 2
naked mole-rat(101697794) NK2 homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108693 Anti-NKX2-2 affinity isolated antibody sheep, zebrafish, rabbit, canine, guinea pig, horse, rat, human, rat, mouse
western blot pricing
HPA003468 Anti-NKX2-2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV37110 Anti-NKX2-2 antibody produced in rabbit affinity isolated antibody , canine, rat, sheep, rabbit, bovine, zebrafish, mouse, human, horse, guinea pig
western blot pricing
SAB2101599 Anti-NKX2-2 antibody produced in rabbit affinity isolated antibody rabbit, rat, zebrafish, bovine, human, mouse, guinea pig, canine, horse, sheep
western blot pricing
SAB2103965 Anti-NKX2-2, (N-terminal) antibody produced in rabbit affinity isolated antibody rat, bovine, canine, human, mouse, sheep, rabbit, guinea pig, horse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002509 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010919 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010919 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010919 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119891 MISSION® esiRNA esiRNA human NKX2-2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002509 Rosetta Predictions human pricing
XM_001056116 Rosetta Predictions rat pricing
XM_345446 Rosetta Predictions rat pricing
NM_001077632 Rosetta Predictions mouse pricing
NM_010919 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139872 predicted 731
2 SASI_Hs01_00139873 predicted 989
3 SASI_Hs01_00139874 predicted 741
4 SASI_Hs01_00139875 predicted 682
5 SASI_Hs01_00139876 predicted 917
6 SASI_Hs01_00139877 predicted 1002
7 SASI_Hs01_00139878 predicted 987
8 SASI_Hs01_00139879 predicted 678
9 SASI_Hs01_00139880 predicted 973
10 SASI_Hs01_00139881 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282069 predicted 1589
2 SASI_Rn02_00282070 predicted 1625
3 SASI_Rn02_00282071 predicted 1601
4 SASI_Rn02_00282072 predicted 1604
5 SASI_Rn02_00282073 predicted 1004
6 SASI_Rn02_00282074 predicted 696
7 SASI_Rn02_00282075 predicted 702
8 SASI_Rn02_00282076 predicted 988
9 SASI_Rn02_00282077 predicted 1627
10 SASI_Rn02_00282078 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345446 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398407 predicted 610
2 SASI_Rn02_00398408 predicted 1631
3 SASI_Rn02_00398409 predicted 1625
4 SASI_Rn02_00398410 predicted 1609
5 SASI_Rn02_00398411 predicted 527
6 SASI_Rn02_00398412 predicted 527
7 SASI_Rn02_00398413 predicted 583
8 SASI_Rn02_00398414 predicted 1626
9 SASI_Rn02_00398415 predicted 497
10 SASI_Rn02_00398416 predicted 1626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292807 predicted 613
2 SASI_Mm02_00292808 predicted 704
3 SASI_Mm02_00292809 predicted 694
4 SASI_Mm02_00292810 predicted 690
5 SASI_Mm02_00292811 predicted 705
6 SASI_Mm02_00292812 predicted 707
7 SASI_Mm02_00292813 predicted 613
8 SASI_Mm02_00292814 predicted 700
9 SASI_Mm02_00292815 predicted 703
10 SASI_Mm02_00292816 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319657 predicted 611
2 SASI_Mm02_00319658 predicted 701
3 SASI_Mm02_00319659 predicted 700
4 SASI_Mm02_00319660 predicted 691
5 SASI_Mm01_00124517 predicted 706
6 SASI_Mm02_00319661 predicted 706
7 SASI_Mm02_00319662 predicted 615
8 SASI_Mm02_00319663 predicted 696
9 SASI_Mm01_00124518 predicted 706
10 SASI_Mm02_00319664 predicted 690
11 SASI_Mm01_00124519 predicted 978
12 SASI_Mm01_00124520 predicted 902
13 SASI_Mm01_00124521 predicted 963
14 SASI_Mm01_00124522 predicted 836
15 SASI_Mm01_00124523 predicted 846
16 SASI_Mm01_00124524 predicted 917
17 SASI_Mm01_00124525 predicted 1483
18 SASI_Mm01_00124526 predicted 1611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002509
NKX2-2 MISSION shRNA Bacterial Glycerol Stock
NK2 homeobox 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002509.2-1427s1c1
Sequence:CCGGCGCCGTGTTTACAGAATGTTTCTCGAGAAACATTCTGTAAACACGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002509.2-549s1c1
Sequence:CCGGCTTCTACGACAGCAGCGACAACTCGAGTTGTCGCTGCTGTCGTAGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002509.2-993s1c1
Sequence:CCGGCAAACCATGTCACGCGCTCAACTCGAGTTGAGCGCGTGACATGGTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002509.2-679s1c1
Sequence:CCGGGCCGACGAGTCACCGGACAATCTCGAGATTGTCCGGTGACTCGTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002509.2-408s1c1
Sequence:CCGGCCTGCCGGACACCAACGATGACTCGAGTCATCGTTGGTGTCCGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002509.2-1570s21c1
Sequence:CCGGGTTTGTGTGAGTAGCGATATTCTCGAGAATATCGCTACTCACACAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002509
NKX2-2 MISSION shRNA shRNA Plasmid DNA
NK2 homeobox 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002509.2-1427s1c1
Sequence:CCGGCGCCGTGTTTACAGAATGTTTCTCGAGAAACATTCTGTAAACACGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002509.2-549s1c1
Sequence:CCGGCTTCTACGACAGCAGCGACAACTCGAGTTGTCGCTGCTGTCGTAGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002509.2-993s1c1
Sequence:CCGGCAAACCATGTCACGCGCTCAACTCGAGTTGAGCGCGTGACATGGTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002509.2-679s1c1
Sequence:CCGGGCCGACGAGTCACCGGACAATCTCGAGATTGTCCGGTGACTCGTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002509.2-408s1c1
Sequence:CCGGCCTGCCGGACACCAACGATGACTCGAGTCATCGTTGGTGTCCGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002509.2-1570s21c1
Sequence:CCGGGTTTGTGTGAGTAGCGATATTCTCGAGAATATCGCTACTCACACAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002509
NKX2-2 MISSION shRNA Lentiviral Transduction Particles
NK2 homeobox 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002509.2-1427s1c1
Sequence:CCGGCGCCGTGTTTACAGAATGTTTCTCGAGAAACATTCTGTAAACACGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002509.2-549s1c1
Sequence:CCGGCTTCTACGACAGCAGCGACAACTCGAGTTGTCGCTGCTGTCGTAGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002509.2-993s1c1
Sequence:CCGGCAAACCATGTCACGCGCTCAACTCGAGTTGAGCGCGTGACATGGTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002509.2-679s1c1
Sequence:CCGGGCCGACGAGTCACCGGACAATCTCGAGATTGTCCGGTGACTCGTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002509.2-408s1c1
Sequence:CCGGCCTGCCGGACACCAACGATGACTCGAGTCATCGTTGGTGTCCGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002509.2-1570s21c1
Sequence:CCGGGTTTGTGTGAGTAGCGATATTCTCGAGAATATCGCTACTCACACAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010919
NKX2-2 MISSION shRNA Bacterial Glycerol Stock
NK2 homeobox 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010919.1-1545s1c1
Sequence:CCGGCCGCACTGCTTTCGTGAATTTCTCGAGAAATTCACGAAAGCAGTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010919.1-1075s1c1
Sequence:CCGGCATGCAGTACAACGCCCAGTACTCGAGTACTGGGCGTTGTACTGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010919.1-665s1c1
Sequence:CCGGGCTGACGAGTCACCGGACAATCTCGAGATTGTCCGGTGACTCGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010919.1-878s1c1
Sequence:CCGGCATCGCTACAAGATGAAACGTCTCGAGACGTTTCATCTTGTAGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010919.1-745s1c1
Sequence:CCGGCTTCTCCAAAGCGCAGACCTACTCGAGTAGGTCTGCGCTTTGGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010919.2-437s21c1
Sequence:CCGGTTCCGGACACCAACGATGAAGCTCGAGCTTCATCGTTGGTGTCCGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010919.2-1444s21c1
Sequence:CCGGTAGAACTCTAAGCCGTGTTTACTCGAGTAAACACGGCTTAGAGTTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010919.2-1513s21c1
Sequence:CCGGACCAAACCATCCCAACGTTAACTCGAGTTAACGTTGGGATGGTTTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010919
NKX2-2 MISSION shRNA shRNA Plasmid DNA
NK2 homeobox 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010919.1-1545s1c1
Sequence:CCGGCCGCACTGCTTTCGTGAATTTCTCGAGAAATTCACGAAAGCAGTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010919.1-1075s1c1
Sequence:CCGGCATGCAGTACAACGCCCAGTACTCGAGTACTGGGCGTTGTACTGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010919.1-665s1c1
Sequence:CCGGGCTGACGAGTCACCGGACAATCTCGAGATTGTCCGGTGACTCGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010919.1-878s1c1
Sequence:CCGGCATCGCTACAAGATGAAACGTCTCGAGACGTTTCATCTTGTAGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010919.1-745s1c1
Sequence:CCGGCTTCTCCAAAGCGCAGACCTACTCGAGTAGGTCTGCGCTTTGGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010919.2-437s21c1
Sequence:CCGGTTCCGGACACCAACGATGAAGCTCGAGCTTCATCGTTGGTGTCCGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010919.2-1444s21c1
Sequence:CCGGTAGAACTCTAAGCCGTGTTTACTCGAGTAAACACGGCTTAGAGTTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010919.2-1513s21c1
Sequence:CCGGACCAAACCATCCCAACGTTAACTCGAGTTAACGTTGGGATGGTTTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010919
NKX2-2 MISSION shRNA Lentiviral Transduction Particles
NK2 homeobox 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010919.1-1545s1c1
Sequence:CCGGCCGCACTGCTTTCGTGAATTTCTCGAGAAATTCACGAAAGCAGTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010919.1-1075s1c1
Sequence:CCGGCATGCAGTACAACGCCCAGTACTCGAGTACTGGGCGTTGTACTGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010919.1-665s1c1
Sequence:CCGGGCTGACGAGTCACCGGACAATCTCGAGATTGTCCGGTGACTCGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010919.1-878s1c1
Sequence:CCGGCATCGCTACAAGATGAAACGTCTCGAGACGTTTCATCTTGTAGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010919.1-745s1c1
Sequence:CCGGCTTCTCCAAAGCGCAGACCTACTCGAGTAGGTCTGCGCTTTGGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010919.2-437s21c1
Sequence:CCGGTTCCGGACACCAACGATGAAGCTCGAGCTTCATCGTTGGTGTCCGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010919.2-1444s21c1
Sequence:CCGGTAGAACTCTAAGCCGTGTTTACTCGAGTAAACACGGCTTAGAGTTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010919.2-1513s21c1
Sequence:CCGGACCAAACCATCCCAACGTTAACTCGAGTTAACGTTGGGATGGTTTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)