EMAIL THIS PAGE TO A FRIEND

NKX2-3

NK2 homeobox 3

69 Gene Product Result for
Synonyms: CSX3 NK2.3 NKX2.3 NKX2C NKX4-3
UniProtKB ID: Q8TAU0, B4DUZ4, Q9NYS6
Gene ID:
Human(159296) Summary: This gene encodes a homeodomain-containing transcription factor. The encoded protein is a member of the NKX family of homeodomain transcription factors. Studies of similar proteins in mouse and rat have indicated a potential role in cellular differentiation.[provided by RefSeq, Mar 2010]
Mouse(18089) NK2 homeobox 3
Rat(309389) NK2 homeobox 3
sheep(101110636) NK2 homeobox 3
naked mole-rat(101713993) NK2 homeobox 3
chicken(395888) NK2 transcription factor related, locus 3
dog(100684882) NK2 homeobox 3
cow(539451) NK2 homeobox 3
domestic cat(101089216) NK2 homeobox 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145285 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008699 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008699 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008699 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050521 MISSION® esiRNA esiRNA human NKX2-3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145285 Rosetta Predictions human pricing
NM_001107594 Rosetta Predictions rat pricing
NM_008699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365165 predicted 1775
2 SASI_Hs01_00095784 predicted 384
3 SASI_Hs01_00095785 predicted 1666
4 SASI_Hs02_00365166 predicted 1773
5 SASI_Hs01_00095786 predicted 298
6 SASI_Hs02_00365167 predicted 1789
7 SASI_Hs01_00095788 predicted 1492
8 SASI_Hs01_00095791 predicted 788
9 SASI_Hs01_00095792 predicted 668
10 SASI_Hs01_00095793 predicted 1587
11 SASI_Hs01_00095787 predicted 1551
12 SASI_Hs01_00095789 predicted 1384
13 SASI_Hs01_00095790 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230375 predicted 243
2 SASI_Rn02_00230376 predicted 1197
3 SASI_Rn02_00230377 predicted 247
4 SASI_Rn02_00230378 predicted 1070
5 SASI_Rn02_00230379 predicted 200
6 SASI_Rn02_00230380 predicted 258
7 SASI_Rn02_00230381 predicted 1243
8 SASI_Rn02_00230382 predicted 362
9 SASI_Rn02_00230383 predicted 324
10 SASI_Rn02_00230384 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051619 predicted 438
2 SASI_Mm01_00051621 predicted 627
3 SASI_Mm01_00051622 predicted 249
4 SASI_Mm01_00051623 predicted 1376
5 SASI_Mm01_00051624 predicted 1425
6 SASI_Mm01_00051625 predicted 491
7 SASI_Mm01_00051626 predicted 410
8 SASI_Mm01_00051627 predicted 556
9 SASI_Mm01_00051628 predicted 487
10 SASI_Mm02_00314516 predicted 255
11 SASI_Mm01_00051620 predicted 1317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145285
NKX2-3 MISSION shRNA Bacterial Glycerol Stock
NK2 homeobox 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145285.2-1597s21c1
Sequence:CCGGTTGGTTCTTCCAAAGCGAGAACTCGAGTTCTCGCTTTGGAAGAACCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145285.2-503s21c1
Sequence:CCGGAGCGAGCCCAAGGAACATGAACTCGAGTTCATGTTCCTTGGGCTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145285.1-376s1c1
Sequence:CCGGAGGGCGAGAAATTGTCCTATTCTCGAGAATAGGACAATTTCTCGCCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145285.1-662s1c1
Sequence:CCGGCGAGCTGGAACGCAGGTTCAACTCGAGTTGAACCTGCGTTCCAGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145285.1-764s1c1
Sequence:CCGGGTTCCAGAATCGCAGGTACAACTCGAGTTGTACCTGCGATTCTGGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145285.1-944s1c1
Sequence:CCGGCGCCTACTCCTACAACAGCTTCTCGAGAAGCTGTTGTAGGAGTAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145285.1-254s1c1
Sequence:CCGGGCACTTCCATGGTGCGCACTTCTCGAGAAGTGCGCACCATGGAAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145285
NKX2-3 MISSION shRNA shRNA Plasmid DNA
NK2 homeobox 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145285.2-1597s21c1
Sequence:CCGGTTGGTTCTTCCAAAGCGAGAACTCGAGTTCTCGCTTTGGAAGAACCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145285.2-503s21c1
Sequence:CCGGAGCGAGCCCAAGGAACATGAACTCGAGTTCATGTTCCTTGGGCTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145285.1-376s1c1
Sequence:CCGGAGGGCGAGAAATTGTCCTATTCTCGAGAATAGGACAATTTCTCGCCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145285.1-662s1c1
Sequence:CCGGCGAGCTGGAACGCAGGTTCAACTCGAGTTGAACCTGCGTTCCAGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145285.1-764s1c1
Sequence:CCGGGTTCCAGAATCGCAGGTACAACTCGAGTTGTACCTGCGATTCTGGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145285.1-944s1c1
Sequence:CCGGCGCCTACTCCTACAACAGCTTCTCGAGAAGCTGTTGTAGGAGTAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145285.1-254s1c1
Sequence:CCGGGCACTTCCATGGTGCGCACTTCTCGAGAAGTGCGCACCATGGAAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145285
NKX2-3 MISSION shRNA Lentiviral Transduction Particles
NK2 homeobox 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145285.2-1597s21c1
Sequence:CCGGTTGGTTCTTCCAAAGCGAGAACTCGAGTTCTCGCTTTGGAAGAACCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145285.2-503s21c1
Sequence:CCGGAGCGAGCCCAAGGAACATGAACTCGAGTTCATGTTCCTTGGGCTCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145285.1-376s1c1
Sequence:CCGGAGGGCGAGAAATTGTCCTATTCTCGAGAATAGGACAATTTCTCGCCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145285.1-662s1c1
Sequence:CCGGCGAGCTGGAACGCAGGTTCAACTCGAGTTGAACCTGCGTTCCAGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145285.1-764s1c1
Sequence:CCGGGTTCCAGAATCGCAGGTACAACTCGAGTTGTACCTGCGATTCTGGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145285.1-944s1c1
Sequence:CCGGCGCCTACTCCTACAACAGCTTCTCGAGAAGCTGTTGTAGGAGTAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145285.1-254s1c1
Sequence:CCGGGCACTTCCATGGTGCGCACTTCTCGAGAAGTGCGCACCATGGAAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008699
NKX2-3 MISSION shRNA Bacterial Glycerol Stock
NK2 homeobox 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008699.2-1312s1c1
Sequence:CCGGCGCGGGAATGAGACACGAGAACTCGAGTTCTCGTGTCTCATTCCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008699.2-441s1c1
Sequence:CCGGCAGAGCTATGTCCATACAGTTCTCGAGAACTGTATGGACATAGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008699.2-1130s1c1
Sequence:CCGGCGGCGGTGGATCCTTTGTGAACTCGAGTTCACAAAGGATCCACCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008699.2-381s1c1
Sequence:CCGGCTGTCCTATTTGAACTCACTACTCGAGTAGTGAGTTCAAATAGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008699.2-370s1c1
Sequence:CCGGAGGGAGAGAAACTGTCCTATTCTCGAGAATAGGACAGTTTCTCTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008699
NKX2-3 MISSION shRNA shRNA Plasmid DNA
NK2 homeobox 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008699.2-1312s1c1
Sequence:CCGGCGCGGGAATGAGACACGAGAACTCGAGTTCTCGTGTCTCATTCCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008699.2-441s1c1
Sequence:CCGGCAGAGCTATGTCCATACAGTTCTCGAGAACTGTATGGACATAGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008699.2-1130s1c1
Sequence:CCGGCGGCGGTGGATCCTTTGTGAACTCGAGTTCACAAAGGATCCACCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008699.2-381s1c1
Sequence:CCGGCTGTCCTATTTGAACTCACTACTCGAGTAGTGAGTTCAAATAGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008699.2-370s1c1
Sequence:CCGGAGGGAGAGAAACTGTCCTATTCTCGAGAATAGGACAGTTTCTCTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008699
NKX2-3 MISSION shRNA Lentiviral Transduction Particles
NK2 homeobox 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008699.2-1312s1c1
Sequence:CCGGCGCGGGAATGAGACACGAGAACTCGAGTTCTCGTGTCTCATTCCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008699.2-441s1c1
Sequence:CCGGCAGAGCTATGTCCATACAGTTCTCGAGAACTGTATGGACATAGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008699.2-1130s1c1
Sequence:CCGGCGGCGGTGGATCCTTTGTGAACTCGAGTTCACAAAGGATCCACCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008699.2-381s1c1
Sequence:CCGGCTGTCCTATTTGAACTCACTACTCGAGTAGTGAGTTCAAATAGGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008699.2-370s1c1
Sequence:CCGGAGGGAGAGAAACTGTCCTATTCTCGAGAATAGGACAGTTTCTCTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)