EMAIL THIS PAGE TO A FRIEND

NKX2-5

NK2 homeobox 5

54 Gene Product Result for
Synonyms: CHNG5 CSX CSX1 HLHS2 NKX2.5 NKX2E NKX4-1 VSD3
UniProtKB ID: P52952, A8K3K0, B4DNB6, E9PBU6
Gene ID:
Human(1482) Summary: This gene encodes a homeobox-containing transcription factor. This transcription factor functions in heart formation and development. Mutations in this gene cause atrial septal defect with atrioventricular conduction defect, and also tetralogy of Fallot, which are both heart malformation diseases. Mutations in this gene can also cause congenital hypothyroidism non-goitrous type 5, a non-autoimmune condition. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(18091) NK2 homeobox 5
Rat(114109) NK2 homeobox 5
sheep(101109645) NK2 homeobox 5
naked mole-rat(101724475) NK2 homeobox 5
chicken(396073) NK2 transcription factor related, locus 5 (Drosophila)
cow(538870) NK2 homeobox 5
domestic cat(101090739) NK2 homeobox 5
dog(489113) NK2 homeobox 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108694 Anti-NKX2-5 affinity isolated antibody human
western blot pricing
N7414 Anti-NKX2-5 (121-135) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
N7289 Anti-NKX2-5 (91-105) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2501264 Anti-NKX2-5 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB2101601 Anti-NKX2-5 antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, rat, canine, rabbit, human, horse, bovine, mouse
western blot pricing
SAB1410255 Anti-NKX2-5 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA065034 Anti-NKX2-5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB2102990 Anti-NKX2-5, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
WH0001482M1 Monoclonal Anti-NKX2-5 antibody produced in mouse clone 1E4-G5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408911 Monoclonal Anti-NKX2-5 antibody produced in mouse clone 3C1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1408912 Monoclonal Anti-NKX2-5 antibody produced in mouse clone 4B11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB1403709 Monoclonal Anti-NKX2-5, (N-terminal) antibody produced in mouse clone 3A7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008700 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008700 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008700 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004387 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU078651 MISSION® esiRNA esiRNA targeting mouse Nkx2-5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004387 Rosetta Predictions human pricing
NM_053651 Rosetta Predictions rat pricing
NM_008700 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098163 predicted 1333
2 SASI_Hs01_00098164 predicted 474
3 SASI_Hs01_00098165 predicted 445
4 SASI_Hs01_00098166 predicted 1326
5 SASI_Hs01_00098167 predicted 1317
6 SASI_Hs01_00098168 predicted 477
7 SASI_Hs01_00098169 predicted 1118
8 SASI_Hs01_00098170 predicted 438
9 SASI_Hs01_00098171 predicted 1029
10 SASI_Hs02_00337495 predicted 1100
11 SASI_Hs01_00098162 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053651 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067130 predicted 230
2 SASI_Rn01_00067131 predicted 654
3 SASI_Rn01_00067132 predicted 392
4 SASI_Rn01_00067133 predicted 460
5 SASI_Rn01_00067134 predicted 237
6 SASI_Rn01_00067135 predicted 422
7 SASI_Rn01_00067136 predicted 215
8 SASI_Rn01_00067138 predicted 547
9 SASI_Rn01_00067139 predicted 389
10 SASI_Rn02_00266373 predicted 548
11 SASI_Rn01_00067137 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138957 predicted 513
2 SASI_Mm01_00138958 predicted 445
3 SASI_Mm01_00138959 predicted 245
4 SASI_Mm01_00138960 predicted 1291
5 SASI_Mm01_00138961 predicted 766
6 SASI_Mm01_00138962 predicted 351
7 SASI_Mm01_00138963 predicted 340
8 SASI_Mm01_00138964 predicted 578
9 SASI_Mm01_00138965 predicted 540
10 SASI_Mm01_00138966 predicted 228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008700
NKX2-5 MISSION shRNA Bacterial Glycerol Stock
NK2 homeobox 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008700.2-1251s21c1
Sequence:CCGGTATGCCCTGTCCCTCAGATTTCTCGAGAAATCTGAGGGACAGGGCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008700.2-358s21c1
Sequence:CCGGTTCAAGCCCGAGGCCTACTCTCTCGAGAGAGTAGGCCTCGGGCTTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008700.2-1206s21c1
Sequence:CCGGCCTTTAGGAGAAGGGCGATGACTCGAGTCATCGCCCTTCTCCTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008700.1-1376s1c1
Sequence:CCGGCCATCCCACTTTATTGACGTACTCGAGTACGTCAATAAAGTGGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008700.1-837s1c1
Sequence:CCGGCGTCGCTACAAGTGCAAGCGACTCGAGTCGCTTGCACTTGTAGCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008700.1-1211s1c1
Sequence:CCGGGCACGGCATCCGAGCCTGGTACTCGAGTACCAGGCTCGGATGCCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008700.1-1118s1c1
Sequence:CCGGCGCCAACAGCAACTTCGTGAACTCGAGTTCACGAAGTTGCTGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008700
NKX2-5 MISSION shRNA shRNA Plasmid DNA
NK2 homeobox 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008700.2-1251s21c1
Sequence:CCGGTATGCCCTGTCCCTCAGATTTCTCGAGAAATCTGAGGGACAGGGCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008700.2-358s21c1
Sequence:CCGGTTCAAGCCCGAGGCCTACTCTCTCGAGAGAGTAGGCCTCGGGCTTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008700.2-1206s21c1
Sequence:CCGGCCTTTAGGAGAAGGGCGATGACTCGAGTCATCGCCCTTCTCCTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008700.1-1376s1c1
Sequence:CCGGCCATCCCACTTTATTGACGTACTCGAGTACGTCAATAAAGTGGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008700.1-837s1c1
Sequence:CCGGCGTCGCTACAAGTGCAAGCGACTCGAGTCGCTTGCACTTGTAGCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008700.1-1211s1c1
Sequence:CCGGGCACGGCATCCGAGCCTGGTACTCGAGTACCAGGCTCGGATGCCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008700.1-1118s1c1
Sequence:CCGGCGCCAACAGCAACTTCGTGAACTCGAGTTCACGAAGTTGCTGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008700
NKX2-5 MISSION shRNA Lentiviral Transduction Particles
NK2 homeobox 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008700.2-1251s21c1
Sequence:CCGGTATGCCCTGTCCCTCAGATTTCTCGAGAAATCTGAGGGACAGGGCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008700.2-358s21c1
Sequence:CCGGTTCAAGCCCGAGGCCTACTCTCTCGAGAGAGTAGGCCTCGGGCTTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008700.2-1206s21c1
Sequence:CCGGCCTTTAGGAGAAGGGCGATGACTCGAGTCATCGCCCTTCTCCTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008700.1-1376s1c1
Sequence:CCGGCCATCCCACTTTATTGACGTACTCGAGTACGTCAATAAAGTGGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008700.1-837s1c1
Sequence:CCGGCGTCGCTACAAGTGCAAGCGACTCGAGTCGCTTGCACTTGTAGCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008700.1-1211s1c1
Sequence:CCGGGCACGGCATCCGAGCCTGGTACTCGAGTACCAGGCTCGGATGCCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008700.1-1118s1c1
Sequence:CCGGCGCCAACAGCAACTTCGTGAACTCGAGTTCACGAAGTTGCTGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004387
VALIDATED
NKX2-5 MISSION shRNA Bacterial Glycerol Stock
NK2 homeobox 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004387.2-1037s21c1
Sequence:CCGGCGCCAACAACAACTTCGTGAACTCGAGTTCACGAAGTTGTTGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004387.2-1308s21c1
Sequence:CCGGTTCTTGCGCACGGGAGAGTTTCTCGAGAAACTCTCCCGTGCGCAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004387.2-1118s21c1
Sequence:CCGGAGTGTCCACGCTGCATGGTATCTCGAGATACCATGCAGCGTGGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004387.2-907s21c1
Sequence:CCGGGCCTCAATCCCTACGGTTATACTCGAGTATAACCGTAGGGATTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004387.1-907s1c1
Sequence:CCGGGCCTCAATCCCTACGGTTATACTCGAGTATAACCGTAGGGATTGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004387.1-1333s1c1
Sequence:CCGGCGGCGATTATGCAGCGTGCAACTCGAGTTGCACGCTGCATAATCGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004387.1-1037s1c1
Sequence:CCGGCGCCAACAACAACTTCGTGAACTCGAGTTCACGAAGTTGTTGTTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004387.1-446s1c1
Sequence:CCGGCGCCTTCTATCCACGTGCCTACTCGAGTAGGCACGTGGATAGAAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004387.1-211s1c1
Sequence:CCGGTCTCAGTCAAAGACATCCTAACTCGAGTTAGGATGTCTTTGACTGAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004387
VALIDATED
NKX2-5 MISSION shRNA shRNA Plasmid DNA
NK2 homeobox 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004387.2-1037s21c1
Sequence:CCGGCGCCAACAACAACTTCGTGAACTCGAGTTCACGAAGTTGTTGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004387.2-1308s21c1
Sequence:CCGGTTCTTGCGCACGGGAGAGTTTCTCGAGAAACTCTCCCGTGCGCAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004387.2-1118s21c1
Sequence:CCGGAGTGTCCACGCTGCATGGTATCTCGAGATACCATGCAGCGTGGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004387.2-907s21c1
Sequence:CCGGGCCTCAATCCCTACGGTTATACTCGAGTATAACCGTAGGGATTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004387.1-907s1c1
Sequence:CCGGGCCTCAATCCCTACGGTTATACTCGAGTATAACCGTAGGGATTGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004387.1-1333s1c1
Sequence:CCGGCGGCGATTATGCAGCGTGCAACTCGAGTTGCACGCTGCATAATCGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004387.1-1037s1c1
Sequence:CCGGCGCCAACAACAACTTCGTGAACTCGAGTTCACGAAGTTGTTGTTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004387.1-446s1c1
Sequence:CCGGCGCCTTCTATCCACGTGCCTACTCGAGTAGGCACGTGGATAGAAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004387.1-211s1c1
Sequence:CCGGTCTCAGTCAAAGACATCCTAACTCGAGTTAGGATGTCTTTGACTGAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004387
VALIDATED
NKX2-5 MISSION shRNA Lentiviral Transduction Particles
NK2 homeobox 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004387.2-1037s21c1
Sequence:CCGGCGCCAACAACAACTTCGTGAACTCGAGTTCACGAAGTTGTTGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004387.2-1308s21c1
Sequence:CCGGTTCTTGCGCACGGGAGAGTTTCTCGAGAAACTCTCCCGTGCGCAAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004387.2-1118s21c1
Sequence:CCGGAGTGTCCACGCTGCATGGTATCTCGAGATACCATGCAGCGTGGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004387.2-907s21c1
Sequence:CCGGGCCTCAATCCCTACGGTTATACTCGAGTATAACCGTAGGGATTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004387.1-907s1c1
Sequence:CCGGGCCTCAATCCCTACGGTTATACTCGAGTATAACCGTAGGGATTGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004387.1-1333s1c1
Sequence:CCGGCGGCGATTATGCAGCGTGCAACTCGAGTTGCACGCTGCATAATCGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004387.1-1037s1c1
Sequence:CCGGCGCCAACAACAACTTCGTGAACTCGAGTTCACGAAGTTGTTGTTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004387.1-446s1c1
Sequence:CCGGCGCCTTCTATCCACGTGCCTACTCGAGTAGGCACGTGGATAGAAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004387.1-211s1c1
Sequence:CCGGTCTCAGTCAAAGACATCCTAACTCGAGTTAGGATGTCTTTGACTGAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)