EMAIL THIS PAGE TO A FRIEND

NKX3-1

NK3 homeobox 1

230 Gene Product Result for
Synonyms: BAPX2 NKX3 NKX3.1 NKX3A
Gene ID:
Human(4824) Summary: This gene encodes a homeobox-containing transcription factor. This transcription factor functions as a negative regulator of epithelial cell growth in prostate tissue. Aberrant expression of this gene is associated with prostate tumor progression. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jan 2012]
Mouse(18095) NK-3 transcription factor, locus 1 (Drosophila)
Rat(305999) NK3 homeobox 1
Zebrafish(555375) NK3 homeobox 1
chicken(101668295) NK3 homeobox 1
dog(486114) NK3 homeobox 1
cow(782252) NK3 homeobox 1
chicken(101747314) NK3 homeobox 1
sheep(101113199) NK3 homeobox 1
naked mole-rat(101702066) NK3 homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010921 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010921 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010921 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006167 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006167 Rosetta Predictions human pricing
NM_001034144 Rosetta Predictions rat pricing
NM_010921 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341026 predicted 880
2 SASI_Hs01_00018365 predicted 1121
3 SASI_Hs01_00018366 predicted 688
4 SASI_Hs02_00341027 predicted 955
5 SASI_Hs01_00018367 predicted 569
6 SASI_Hs01_00018368 predicted 560
7 SASI_Hs01_00018369 predicted 1156
8 SASI_Hs01_00018370 predicted 559
9 SASI_Hs01_00018371 predicted 750
10 SASI_Hs01_00018372 predicted 1195
11 SASI_Hs01_00018364 predicted 912
12 SASI_Hs01_00018373 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066846 predicted 1123
2 SASI_Rn01_00066848 predicted 1070
3 SASI_Rn01_00066849 predicted 1018
4 SASI_Rn01_00066850 predicted 331
5 SASI_Rn01_00066851 predicted 827
6 SASI_Rn01_00066852 predicted 1213
7 SASI_Rn01_00066853 predicted 971
8 SASI_Rn01_00066854 predicted 604
9 SASI_Rn01_00066855 predicted 956
10 SASI_Rn02_00203997 predicted 1042
11 SASI_Rn01_00066847 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010921 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073755 predicted 1212
2 SASI_Mm01_00073757 predicted 1131
3 SASI_Mm02_00319665 predicted 1156
4 SASI_Mm01_00073758 predicted 1031
5 SASI_Mm01_00073759 predicted 522
6 SASI_Mm01_00073760 predicted 400
7 SASI_Mm01_00073761 predicted 874
8 SASI_Mm01_00073762 predicted 819
9 SASI_Mm01_00073763 predicted 277
10 SASI_Mm01_00073764 predicted 969
11 SASI_Mm01_00073756 predicted 539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010921
NKX3-1 MISSION shRNA Bacterial Glycerol Stock
NK3 homeobox 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010921.3-1135s21c1
Sequence:CCGGGAGGATTTCCTCTTGAGTTAACTCGAGTTAACTCAAGAGGAAATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010921.3-606s21c1
Sequence:CCGGTGTCTTTGCCAGCCCTGAAAGCTCGAGCTTTCAGGGCTGGCAAAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010921.1-541s1c1
Sequence:CCGGACGCTATAAGACCAAGCGAAACTCGAGTTTCGCTTGGTCTTATAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010921.1-1959s1c1
Sequence:CCGGGCTGAAGATGACAGGTTCTTTCTCGAGAAAGAACCTGTCATCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010921.1-658s1c1
Sequence:CCGGCGTGTATACTAGCTATCCCTACTCGAGTAGGGATAGCTAGTATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010921.1-503s1c1
Sequence:CCGGCTCACCGAAACCCAAGTCAAACTCGAGTTTGACTTGGGTTTCGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010921.1-529s1c1
Sequence:CCGGGTTCCAGAACAGACGCTATAACTCGAGTTATAGCGTCTGTTCTGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010921.3-292s21c1
Sequence:CCGGACCCGAGTCTGATGCACATTTCTCGAGAAATGTGCATCAGACTCGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010921
NKX3-1 MISSION shRNA shRNA Plasmid DNA
NK3 homeobox 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010921.3-1135s21c1
Sequence:CCGGGAGGATTTCCTCTTGAGTTAACTCGAGTTAACTCAAGAGGAAATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010921.3-606s21c1
Sequence:CCGGTGTCTTTGCCAGCCCTGAAAGCTCGAGCTTTCAGGGCTGGCAAAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010921.1-541s1c1
Sequence:CCGGACGCTATAAGACCAAGCGAAACTCGAGTTTCGCTTGGTCTTATAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010921.1-1959s1c1
Sequence:CCGGGCTGAAGATGACAGGTTCTTTCTCGAGAAAGAACCTGTCATCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010921.1-658s1c1
Sequence:CCGGCGTGTATACTAGCTATCCCTACTCGAGTAGGGATAGCTAGTATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010921.1-503s1c1
Sequence:CCGGCTCACCGAAACCCAAGTCAAACTCGAGTTTGACTTGGGTTTCGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010921.1-529s1c1
Sequence:CCGGGTTCCAGAACAGACGCTATAACTCGAGTTATAGCGTCTGTTCTGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010921.3-292s21c1
Sequence:CCGGACCCGAGTCTGATGCACATTTCTCGAGAAATGTGCATCAGACTCGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010921
NKX3-1 MISSION shRNA Lentiviral Transduction Particles
NK3 homeobox 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010921.3-1135s21c1
Sequence:CCGGGAGGATTTCCTCTTGAGTTAACTCGAGTTAACTCAAGAGGAAATCCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000415105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010921.3-606s21c1
Sequence:CCGGTGTCTTTGCCAGCCCTGAAAGCTCGAGCTTTCAGGGCTGGCAAAGACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000084947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010921.1-541s1c1
Sequence:CCGGACGCTATAAGACCAAGCGAAACTCGAGTTTCGCTTGGTCTTATAGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000084943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010921.1-1959s1c1
Sequence:CCGGGCTGAAGATGACAGGTTCTTTCTCGAGAAAGAACCTGTCATCTTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000084944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010921.1-658s1c1
Sequence:CCGGCGTGTATACTAGCTATCCCTACTCGAGTAGGGATAGCTAGTATACACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000084946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010921.1-503s1c1
Sequence:CCGGCTCACCGAAACCCAAGTCAAACTCGAGTTTGACTTGGGTTTCGGTGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000084945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010921.1-529s1c1
Sequence:CCGGGTTCCAGAACAGACGCTATAACTCGAGTTATAGCGTCTGTTCTGGAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000413110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010921.3-292s21c1
Sequence:CCGGACCCGAGTCTGATGCACATTTCTCGAGAAATGTGCATCAGACTCGGGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006167
VALIDATED
NKX3-1 MISSION shRNA Bacterial Glycerol Stock
NK3 homeobox 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006167.2-562s21c1
Sequence:CCGGTTCCAGAACAGACGCTATAAGCTCGAGCTTATAGCGTCTGTTCTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006167.2-672s21c1
Sequence:CCGGCTCCCTGGTCTCCGTGTATAACTCGAGTTATACACGGAGACCAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006167.x-1417s1c1
Sequence:CCGGCAAGATGCACTCGCTGTGATTCTCGAGAATCACAGCGAGTGCATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006167.2-3098s1c1
Sequence:CCGGGCCTGTTTCTATCCTGTTTAACTCGAGTTAAACAGGATAGAAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006167.2-350s1c1
Sequence:CCGGCTTATCTGTTGGACTCTGAAACTCGAGTTTCAGAGTCCAACAGATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006167.2-539s1c1
Sequence:CCGGCGGAGACCCAAGTGAAGATATCTCGAGATATCTTCACTTGGGTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006167.2-684s1c1
Sequence:CCGGCGTGTATAACAGCTATCCTTACTCGAGTAAGGATAGCTGTTATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006167.x-471s1c1
Sequence:CCGGAAGTTCAGCCATCAGAAGTACTCGAGTACTTCTGATGGCTGAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006167.2-1784s21c1
Sequence:CCGGTAACTTATGCCTCGCTTATTTCTCGAGAAATAAGCGAGGCATAAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006167.2-349s21c1
Sequence:GTACCGGTCTTATCTGTTGGACTCTGAACTCGAGTTCAGAGTCCAACAGATAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006167.2-695s21c1
Sequence:CCGGGCTATCCTTACTACCCATACCCTCGAGGGTATGGGTAGTAAGGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006167.x-567s1c1
Sequence:CCGGAACAGACGCTATAAGACTAACTCGAGTTAGTCTTATAGCGTCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006167
VALIDATED
NKX3-1 MISSION shRNA shRNA Plasmid DNA
NK3 homeobox 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006167.2-562s21c1
Sequence:CCGGTTCCAGAACAGACGCTATAAGCTCGAGCTTATAGCGTCTGTTCTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006167.2-672s21c1
Sequence:CCGGCTCCCTGGTCTCCGTGTATAACTCGAGTTATACACGGAGACCAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006167.x-1417s1c1
Sequence:CCGGCAAGATGCACTCGCTGTGATTCTCGAGAATCACAGCGAGTGCATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006167.2-3098s1c1
Sequence:CCGGGCCTGTTTCTATCCTGTTTAACTCGAGTTAAACAGGATAGAAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006167.2-350s1c1
Sequence:CCGGCTTATCTGTTGGACTCTGAAACTCGAGTTTCAGAGTCCAACAGATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006167.2-539s1c1
Sequence:CCGGCGGAGACCCAAGTGAAGATATCTCGAGATATCTTCACTTGGGTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006167.2-684s1c1
Sequence:CCGGCGTGTATAACAGCTATCCTTACTCGAGTAAGGATAGCTGTTATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006167.x-471s1c1
Sequence:CCGGAAGTTCAGCCATCAGAAGTACTCGAGTACTTCTGATGGCTGAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006167.2-1784s21c1
Sequence:CCGGTAACTTATGCCTCGCTTATTTCTCGAGAAATAAGCGAGGCATAAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006167.2-349s21c1
Sequence:GTACCGGTCTTATCTGTTGGACTCTGAACTCGAGTTCAGAGTCCAACAGATAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006167.2-695s21c1
Sequence:CCGGGCTATCCTTACTACCCATACCCTCGAGGGTATGGGTAGTAAGGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006167.x-567s1c1
Sequence:CCGGAACAGACGCTATAAGACTAACTCGAGTTAGTCTTATAGCGTCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006167
VALIDATED
NKX3-1 MISSION shRNA Lentiviral Transduction Particles
NK3 homeobox 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006167.2-562s21c1
Sequence:CCGGTTCCAGAACAGACGCTATAAGCTCGAGCTTATAGCGTCTGTTCTGGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000226455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006167.2-672s21c1
Sequence:CCGGCTCCCTGGTCTCCGTGTATAACTCGAGTTATACACGGAGACCAGGGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000018354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006167.x-1417s1c1
Sequence:CCGGCAAGATGCACTCGCTGTGATTCTCGAGAATCACAGCGAGTGCATCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006167.2-3098s1c1
Sequence:CCGGGCCTGTTTCTATCCTGTTTAACTCGAGTTAAACAGGATAGAAACAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006167.2-350s1c1
Sequence:CCGGCTTATCTGTTGGACTCTGAAACTCGAGTTTCAGAGTCCAACAGATAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006167.2-539s1c1
Sequence:CCGGCGGAGACCCAAGTGAAGATATCTCGAGATATCTTCACTTGGGTCTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006167.2-684s1c1
Sequence:CCGGCGTGTATAACAGCTATCCTTACTCGAGTAAGGATAGCTGTTATACACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000018353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006167.x-471s1c1
Sequence:CCGGAAGTTCAGCCATCAGAAGTACTCGAGTACTTCTGATGGCTGAACTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000226457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006167.2-1784s21c1
Sequence:CCGGTAACTTATGCCTCGCTTATTTCTCGAGAAATAAGCGAGGCATAAGTTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000218612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006167.2-349s21c1
Sequence:GTACCGGTCTTATCTGTTGGACTCTGAACTCGAGTTCAGAGTCCAACAGATAAGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000226456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006167.2-695s21c1
Sequence:CCGGGCTATCCTTACTACCCATACCCTCGAGGGTATGGGTAGTAAGGATAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000010399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006167.x-567s1c1
Sequence:CCGGAACAGACGCTATAAGACTAACTCGAGTTAGTCTTATAGCGTCTGTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???