EMAIL THIS PAGE TO A FRIEND

NKX6-1

NK6 homeobox 1

58 Gene Product Result for
Synonyms: NKX6.1 NKX6A
UniProtKB ID: P78426
Gene ID:
Human(4825) Summary: In the pancreas, NKX6.1 is required for the development of beta cells and is a potent bifunctional transcription regulator that binds to AT-rich sequences within the promoter region of target genes Iype et al. (2004) [PubMed 15056733]
Mouse(18096) NK6 homeobox 1
Rat(65193) NK6 homeobox 1
chicken(395752) NK6 homeobox 1
domestic cat(101083167) NK6 homeobox 1
cow(616211) NK6 homeobox 1
dog(487838) NK6 homeobox 1
naked mole-rat(101725924) NK6 homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144955 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144955 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144955 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006168 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006168 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006168 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152421 MISSION® esiRNA esiRNA human NKX6-1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006168 Rosetta Predictions human pricing
NM_031737 Rosetta Predictions rat pricing
XM_579527 Rosetta Predictions rat pricing
NM_144955 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066297 predicted 755
2 SASI_Hs01_00066298 predicted 795
3 SASI_Hs01_00066299 predicted 760
4 SASI_Hs01_00066300 predicted 758
5 SASI_Hs01_00066301 predicted 803
6 SASI_Hs01_00066302 predicted 830
7 SASI_Hs01_00066303 predicted 739
8 SASI_Hs01_00066304 predicted 753
9 SASI_Hs01_00066305 predicted 790
10 SASI_Hs01_00066306 predicted 829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065915 predicted 2302
2 SASI_Rn01_00065916 predicted 1674
3 SASI_Rn01_00065917 predicted 2328
4 SASI_Rn01_00065918 predicted 2364
5 SASI_Rn02_00265120 predicted 1582
6 SASI_Rn01_00065919 predicted 2362
7 SASI_Rn01_00065920 predicted 2195
8 SASI_Rn01_00065921 predicted 2325
9 SASI_Rn01_00065922 predicted 1535
10 SASI_Rn02_00265121 predicted 1657
11 SASI_Rn01_00065914 predicted 2387
12 SASI_Rn01_00065923 predicted 1594
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172648 predicted 2395
2 SASI_Rn01_00172649 predicted 2316
3 SASI_Rn01_00172650 predicted 1689
4 SASI_Rn01_00172651 predicted 874
5 SASI_Rn01_00172652 predicted 904
6 SASI_Rn01_00172653 predicted 998
7 SASI_Rn01_00172654 predicted 2387
8 SASI_Rn01_00172655 predicted 1591
9 SASI_Rn01_00172656 predicted 2378
10 SASI_Rn01_00172657 predicted 1798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144955 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199115 predicted 1465
2 SASI_Mm01_00199116 predicted 1366
3 SASI_Mm02_00340481 predicted 1162
4 SASI_Mm01_00199117 predicted 1266
5 SASI_Mm01_00199118 predicted 1188
6 SASI_Mm01_00199119 predicted 1438
7 SASI_Mm01_00199120 predicted 1278
8 SASI_Mm01_00199121 predicted 1349
9 SASI_Mm01_00199123 predicted 1199
10 SASI_Mm01_00199124 predicted 1234
11 SASI_Mm01_00199122 predicted 1200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144955
NKX6-1 MISSION shRNA Bacterial Glycerol Stock
NK6 homeobox 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144955.2-762s21c1
Sequence:CCGGACACGGCATCAACGACATCCTCTCGAGAGGATGTCGTTGATGCCGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144955.2-1474s21c1
Sequence:CCGGCCGAACTCTGACGACGAGAAACTCGAGTTTCTCGTCGTCAGAGTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144955.1-1449s1c1
Sequence:CCGGCGACGATTACAACAAACCTCTCTCGAGAGAGGTTTGTTGTAATCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144955.1-1169s1c1
Sequence:CCGGTGGACAAAGATGGGAAGAGAACTCGAGTTCTCTTCCCATCTTTGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144955.1-1202s1c1
Sequence:CCGGCCACGTTCTCTGGACAGCAAACTCGAGTTTGCTGTCCAGAGAACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144955.1-660s1c1
Sequence:CCGGCCCACCTTTGGGCTCACATAACTCGAGTTATGTGAGCCCAAAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144955.1-549s1c1
Sequence:CCGGCCTGCACAGTATGGCCGAGATCTCGAGATCTCGGCCATACTGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144955.2-1274s21c1
Sequence:CCGGAGAGAGCACGCTTGGCCTATTCTCGAGAATAGGCCAAGCGTGCTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144955.2-1302s21c1
Sequence:CCGGGATGACGGAGAGTCAGGTCAACTCGAGTTGACCTGACTCTCCGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144955
NKX6-1 MISSION shRNA shRNA Plasmid DNA
NK6 homeobox 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144955.2-762s21c1
Sequence:CCGGACACGGCATCAACGACATCCTCTCGAGAGGATGTCGTTGATGCCGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144955.2-1474s21c1
Sequence:CCGGCCGAACTCTGACGACGAGAAACTCGAGTTTCTCGTCGTCAGAGTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144955.1-1449s1c1
Sequence:CCGGCGACGATTACAACAAACCTCTCTCGAGAGAGGTTTGTTGTAATCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144955.1-1169s1c1
Sequence:CCGGTGGACAAAGATGGGAAGAGAACTCGAGTTCTCTTCCCATCTTTGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144955.1-1202s1c1
Sequence:CCGGCCACGTTCTCTGGACAGCAAACTCGAGTTTGCTGTCCAGAGAACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144955.1-660s1c1
Sequence:CCGGCCCACCTTTGGGCTCACATAACTCGAGTTATGTGAGCCCAAAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144955.1-549s1c1
Sequence:CCGGCCTGCACAGTATGGCCGAGATCTCGAGATCTCGGCCATACTGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144955.2-1274s21c1
Sequence:CCGGAGAGAGCACGCTTGGCCTATTCTCGAGAATAGGCCAAGCGTGCTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144955.2-1302s21c1
Sequence:CCGGGATGACGGAGAGTCAGGTCAACTCGAGTTGACCTGACTCTCCGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144955
NKX6-1 MISSION shRNA Lentiviral Transduction Particles
NK6 homeobox 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144955.2-762s21c1
Sequence:CCGGACACGGCATCAACGACATCCTCTCGAGAGGATGTCGTTGATGCCGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144955.2-1474s21c1
Sequence:CCGGCCGAACTCTGACGACGAGAAACTCGAGTTTCTCGTCGTCAGAGTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144955.1-1449s1c1
Sequence:CCGGCGACGATTACAACAAACCTCTCTCGAGAGAGGTTTGTTGTAATCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144955.1-1169s1c1
Sequence:CCGGTGGACAAAGATGGGAAGAGAACTCGAGTTCTCTTCCCATCTTTGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144955.1-1202s1c1
Sequence:CCGGCCACGTTCTCTGGACAGCAAACTCGAGTTTGCTGTCCAGAGAACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144955.1-660s1c1
Sequence:CCGGCCCACCTTTGGGCTCACATAACTCGAGTTATGTGAGCCCAAAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144955.1-549s1c1
Sequence:CCGGCCTGCACAGTATGGCCGAGATCTCGAGATCTCGGCCATACTGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144955.2-1274s21c1
Sequence:CCGGAGAGAGCACGCTTGGCCTATTCTCGAGAATAGGCCAAGCGTGCTCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144955.2-1302s21c1
Sequence:CCGGGATGACGGAGAGTCAGGTCAACTCGAGTTGACCTGACTCTCCGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006168
NKX6-1 MISSION shRNA Bacterial Glycerol Stock
NK6 homeobox 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006168.2-83s21c1
Sequence:CCGGACAGCATGGCCGAGATGAAGACTCGAGTCTTCATCTCGGCCATGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006168.2-800s21c1
Sequence:CCGGAGAGGGCTCGTTTGGCCTATTCTCGAGAATAGGCCAAACGAGCCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006168.2-836s21c1
Sequence:CCGGAGAGTCAGGTCAAGGTCTGGTCTCGAGACCAGACCTTGACCTGACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006168.1-288s1c1
Sequence:CCGGCCCACACGGCATCAACAATATCTCGAGATATTGTTGATGCCGTGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006168.1-695s1c1
Sequence:CCGGTGGACAAAGACGGGAAGAGAACTCGAGTTCTCTTCCCGTCTTTGTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006168.1-106s1c1
Sequence:CCGGCCGCTGTACCCTGCCGCGTATCTCGAGATACGCGGCAGGGTACAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006168.1-762s1c1
Sequence:CCGGGAAGACTTTCGAACAAACAAACTCGAGTTTGTTTGTTCGAAAGTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006168.1-927s1c1
Sequence:CCGGCTCGGAGACAGAGCGCCTCAACTCGAGTTGAGGCGCTCTGTCTCCGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006168.2-734s21c1
Sequence:CCGGTTTCCGGACAGCAGATCTTCGCTCGAGCGAAGATCTGCTGTCCGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006168
NKX6-1 MISSION shRNA shRNA Plasmid DNA
NK6 homeobox 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006168.2-83s21c1
Sequence:CCGGACAGCATGGCCGAGATGAAGACTCGAGTCTTCATCTCGGCCATGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006168.2-800s21c1
Sequence:CCGGAGAGGGCTCGTTTGGCCTATTCTCGAGAATAGGCCAAACGAGCCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006168.2-836s21c1
Sequence:CCGGAGAGTCAGGTCAAGGTCTGGTCTCGAGACCAGACCTTGACCTGACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006168.1-288s1c1
Sequence:CCGGCCCACACGGCATCAACAATATCTCGAGATATTGTTGATGCCGTGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006168.1-695s1c1
Sequence:CCGGTGGACAAAGACGGGAAGAGAACTCGAGTTCTCTTCCCGTCTTTGTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006168.1-106s1c1
Sequence:CCGGCCGCTGTACCCTGCCGCGTATCTCGAGATACGCGGCAGGGTACAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006168.1-762s1c1
Sequence:CCGGGAAGACTTTCGAACAAACAAACTCGAGTTTGTTTGTTCGAAAGTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006168.1-927s1c1
Sequence:CCGGCTCGGAGACAGAGCGCCTCAACTCGAGTTGAGGCGCTCTGTCTCCGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006168.2-734s21c1
Sequence:CCGGTTTCCGGACAGCAGATCTTCGCTCGAGCGAAGATCTGCTGTCCGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006168
NKX6-1 MISSION shRNA Lentiviral Transduction Particles
NK6 homeobox 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006168.2-83s21c1
Sequence:CCGGACAGCATGGCCGAGATGAAGACTCGAGTCTTCATCTCGGCCATGCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006168.2-800s21c1
Sequence:CCGGAGAGGGCTCGTTTGGCCTATTCTCGAGAATAGGCCAAACGAGCCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006168.2-836s21c1
Sequence:CCGGAGAGTCAGGTCAAGGTCTGGTCTCGAGACCAGACCTTGACCTGACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006168.1-288s1c1
Sequence:CCGGCCCACACGGCATCAACAATATCTCGAGATATTGTTGATGCCGTGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006168.1-695s1c1
Sequence:CCGGTGGACAAAGACGGGAAGAGAACTCGAGTTCTCTTCCCGTCTTTGTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006168.1-106s1c1
Sequence:CCGGCCGCTGTACCCTGCCGCGTATCTCGAGATACGCGGCAGGGTACAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006168.1-762s1c1
Sequence:CCGGGAAGACTTTCGAACAAACAAACTCGAGTTTGTTTGTTCGAAAGTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006168.1-927s1c1
Sequence:CCGGCTCGGAGACAGAGCGCCTCAACTCGAGTTGAGGCGCTCTGTCTCCGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006168.2-734s21c1
Sequence:CCGGTTTCCGGACAGCAGATCTTCGCTCGAGCGAAGATCTGCTGTCCGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)