EMAIL THIS PAGE TO A FRIEND

NKX6-2

NK6 homeobox 2

49 Gene Product Result for
Synonyms: GTX NKX6.2 NKX6B
UniProtKB ID: Q9C056, Q5JSF3
Gene ID:
Mouse(14912) NK6 homeobox 2
Rat(309095) NK6 homeobox 2
naked mole-rat(101705222) NK6 homeobox 2
chicken(395591) NK6 homeobox 2
cow(100337358) NK6 homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302284 ANTI-NKX6-2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177400 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177400 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177400 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183248 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183248 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183248 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU079071 MISSION® esiRNA esiRNA targeting mouse Nkx6-2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177400 Rosetta Predictions human pricing
NM_001107558 Rosetta Predictions rat pricing
NM_183248 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225885 predicted 707
2 SASI_Hs01_00225886 predicted 701
3 SASI_Hs02_00369296 predicted 738
4 SASI_Hs02_00369297 predicted 777
5 SASI_Hs02_00369298 predicted 705
6 SASI_Hs02_00369299 predicted 766
7 SASI_Hs02_00369300 predicted 778
8 SASI_Hs02_00369301 predicted 779
9 SASI_Hs02_00369302 predicted 983
10 SASI_Hs02_00369303 predicted 983
11 SASI_Hs01_00225887 predicted 74
12 SASI_Hs01_00225888 predicted 247
13 SASI_Hs01_00225889 predicted 476
14 SASI_Hs01_00225890 predicted 465
15 SASI_Hs01_00225891 predicted 456
16 SASI_Hs01_00225892 predicted 492
17 SASI_Hs01_00225893 predicted 780
18 SASI_Hs01_00225894 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230015 predicted 1502
2 SASI_Rn02_00230016 predicted 743
3 SASI_Rn02_00230017 predicted 875
4 SASI_Rn02_00230018 predicted 291
5 SASI_Rn02_00230019 predicted 1005
6 SASI_Rn02_00230020 predicted 307
7 SASI_Rn02_00230021 predicted 1029
8 SASI_Rn02_00230022 predicted 320
9 SASI_Rn02_00230023 predicted 1582
10 SASI_Rn02_00230024 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026687 predicted 749
2 SASI_Mm02_00350327 predicted 1367
3 SASI_Mm01_00026688 predicted 1451
4 SASI_Mm01_00026689 predicted 1492
5 SASI_Mm01_00026690 predicted 995
6 SASI_Mm01_00026691 predicted 321
7 SASI_Mm01_00026692 predicted 1305
8 SASI_Mm01_00026693 predicted 1471
9 SASI_Mm01_00026695 predicted 1031
10 SASI_Mm01_00026696 predicted 935
11 SASI_Mm01_00026694 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177400
NKX6-2 MISSION shRNA Bacterial Glycerol Stock
NK6 homeobox 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177400.1-420s1c1
Sequence:CCGGCGTCCTGGACAAGGACGGGAACTCGAGTTCCCGTCCTTGTCCAGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177400.1-558s1c1
Sequence:CCGGCATGACCGAGAGCCAGGTGAACTCGAGTTCACCTGGCTCTCGGTCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177400.1-69s1c1
Sequence:CCGGCGAGATGAAGACGTCGCTGTTCTCGAGAACAGCGACGTCTTCATCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177400.1-171s1c1
Sequence:CCGGGCACGGCATCAGCGACATCCTCTCGAGAGGATGTCGCTGATGCCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177400.1-648s1c1
Sequence:CCGGGAAGCAGGACTCGGACGCCGACTCGAGTCGGCGTCCGAGTCCTGCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177400.2-715s21c1
Sequence:CCGGGATGGCGTCGGCCAAGAAGAACTCGAGTTCTTCTTGGCCGACGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177400.2-836s21c1
Sequence:CCGGATCACGCGGCTGCTCAAGAAGCTCGAGCTTCTTGAGCAGCCGCGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177400
NKX6-2 MISSION shRNA shRNA Plasmid DNA
NK6 homeobox 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177400.1-420s1c1
Sequence:CCGGCGTCCTGGACAAGGACGGGAACTCGAGTTCCCGTCCTTGTCCAGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177400.1-558s1c1
Sequence:CCGGCATGACCGAGAGCCAGGTGAACTCGAGTTCACCTGGCTCTCGGTCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177400.1-69s1c1
Sequence:CCGGCGAGATGAAGACGTCGCTGTTCTCGAGAACAGCGACGTCTTCATCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177400.1-171s1c1
Sequence:CCGGGCACGGCATCAGCGACATCCTCTCGAGAGGATGTCGCTGATGCCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177400.1-648s1c1
Sequence:CCGGGAAGCAGGACTCGGACGCCGACTCGAGTCGGCGTCCGAGTCCTGCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177400.2-715s21c1
Sequence:CCGGGATGGCGTCGGCCAAGAAGAACTCGAGTTCTTCTTGGCCGACGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177400.2-836s21c1
Sequence:CCGGATCACGCGGCTGCTCAAGAAGCTCGAGCTTCTTGAGCAGCCGCGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177400
NKX6-2 MISSION shRNA Lentiviral Transduction Particles
NK6 homeobox 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177400.1-420s1c1
Sequence:CCGGCGTCCTGGACAAGGACGGGAACTCGAGTTCCCGTCCTTGTCCAGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177400.1-558s1c1
Sequence:CCGGCATGACCGAGAGCCAGGTGAACTCGAGTTCACCTGGCTCTCGGTCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177400.1-69s1c1
Sequence:CCGGCGAGATGAAGACGTCGCTGTTCTCGAGAACAGCGACGTCTTCATCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177400.1-171s1c1
Sequence:CCGGGCACGGCATCAGCGACATCCTCTCGAGAGGATGTCGCTGATGCCGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177400.1-648s1c1
Sequence:CCGGGAAGCAGGACTCGGACGCCGACTCGAGTCGGCGTCCGAGTCCTGCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177400.2-715s21c1
Sequence:CCGGGATGGCGTCGGCCAAGAAGAACTCGAGTTCTTCTTGGCCGACGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177400.2-836s21c1
Sequence:CCGGATCACGCGGCTGCTCAAGAAGCTCGAGCTTCTTGAGCAGCCGCGTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183248
NKX6-2 MISSION shRNA Bacterial Glycerol Stock
NK6 homeobox 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183248.1-755s1c1
Sequence:CCGGACTTTCGAGCAGACCAAGTATCTCGAGATACTTGGTCTGCTCGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183248.1-1248s1c1
Sequence:CCGGCCGATCACTTTGTATAATCAACTCGAGTTGATTATACAAAGTGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183248.1-311s1c1
Sequence:CCGGCGCTGCACAACATGGCTGAGACTCGAGTCTCAGCCATGTTGTGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183248.1-681s1c1
Sequence:CCGGCCTGGATAAGGATGGCAAGAACTCGAGTTCTTGCCATCCTTATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183248.1-327s1c1
Sequence:CCGGTGAGATGAAGACGTCGCTGTTCTCGAGAACAGCGACGTCTTCATCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183248.3-1028s21c1
Sequence:CCGGAGCACAAACCCTCGAACTTGGCTCGAGCCAAGTTCGAGGGTTTGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183248.3-992s21c1
Sequence:CCGGACTCCGATGACGAGAAGATCACTCGAGTGATCTTCTCGTCATCGGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183248.3-883s21c1
Sequence:CCGGGCAGAGATGGCGTCGGCTAAACTCGAGTTTAGCCGACGCCATCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183248
NKX6-2 MISSION shRNA shRNA Plasmid DNA
NK6 homeobox 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183248.1-755s1c1
Sequence:CCGGACTTTCGAGCAGACCAAGTATCTCGAGATACTTGGTCTGCTCGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183248.1-1248s1c1
Sequence:CCGGCCGATCACTTTGTATAATCAACTCGAGTTGATTATACAAAGTGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183248.1-311s1c1
Sequence:CCGGCGCTGCACAACATGGCTGAGACTCGAGTCTCAGCCATGTTGTGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183248.1-681s1c1
Sequence:CCGGCCTGGATAAGGATGGCAAGAACTCGAGTTCTTGCCATCCTTATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183248.1-327s1c1
Sequence:CCGGTGAGATGAAGACGTCGCTGTTCTCGAGAACAGCGACGTCTTCATCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183248.3-1028s21c1
Sequence:CCGGAGCACAAACCCTCGAACTTGGCTCGAGCCAAGTTCGAGGGTTTGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183248.3-992s21c1
Sequence:CCGGACTCCGATGACGAGAAGATCACTCGAGTGATCTTCTCGTCATCGGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183248.3-883s21c1
Sequence:CCGGGCAGAGATGGCGTCGGCTAAACTCGAGTTTAGCCGACGCCATCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183248
NKX6-2 MISSION shRNA Lentiviral Transduction Particles
NK6 homeobox 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183248.1-755s1c1
Sequence:CCGGACTTTCGAGCAGACCAAGTATCTCGAGATACTTGGTCTGCTCGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183248.1-1248s1c1
Sequence:CCGGCCGATCACTTTGTATAATCAACTCGAGTTGATTATACAAAGTGATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183248.1-311s1c1
Sequence:CCGGCGCTGCACAACATGGCTGAGACTCGAGTCTCAGCCATGTTGTGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183248.1-681s1c1
Sequence:CCGGCCTGGATAAGGATGGCAAGAACTCGAGTTCTTGCCATCCTTATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183248.1-327s1c1
Sequence:CCGGTGAGATGAAGACGTCGCTGTTCTCGAGAACAGCGACGTCTTCATCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183248.3-1028s21c1
Sequence:CCGGAGCACAAACCCTCGAACTTGGCTCGAGCCAAGTTCGAGGGTTTGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183248.3-992s21c1
Sequence:CCGGACTCCGATGACGAGAAGATCACTCGAGTGATCTTCTCGTCATCGGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183248.3-883s21c1
Sequence:CCGGGCAGAGATGGCGTCGGCTAAACTCGAGTTTAGCCGACGCCATCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)