EMAIL THIS PAGE TO A FRIEND

NKX6-3

NK6 homeobox 3

58 Gene Product Result for
Synonyms: NKX6.3
UniProtKB ID: A6NJ46, Q96LR0
Gene ID:
Human(157848) Summary: The NKX family of homeodomain proteins controls numerous developmental processes. Members of the NKX6 subfamily, including NKX6-3, are involved in development of the central nervous system (CNS), gastrointestinal tract, and pancreas (Alanentalo et al., 2006 [PubMed 16326147]
Mouse(74561) NK6 homeobox 3
Rat(685102) NK6 homeobox 3
chicken(431254) NK6 homeobox 3
domestic cat(101082146) NK6 homeobox 3
dog(607413) NK6 homeobox 3
sheep(101121315) NK6 homeobox 3
naked mole-rat(101716875) NK6 homeobox 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152568 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152568 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152568 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_486090 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_486090 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_486090 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_029002 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029002 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029002 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152568 Rosetta Predictions human pricing
NM_001109455 Rosetta Predictions rat pricing
XM_486090 Rosetta Predictions mouse pricing
XM_910682 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156101 predicted 17
2 SASI_Hs01_00156102 predicted 135
3 SASI_Hs01_00156103 predicted 273
4 SASI_Hs01_00156105 predicted 395
5 SASI_Hs01_00156106 predicted 181
6 SASI_Hs01_00156107 predicted 180
7 SASI_Hs01_00156108 predicted 21
8 SASI_Hs01_00156109 predicted 450
9 SASI_Hs02_00366382 predicted 142
10 SASI_Hs02_00366383 predicted 20
11 SASI_Hs01_00156100 predicted 500
12 SASI_Hs01_00156104 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109455 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248577 predicted 359
2 SASI_Rn02_00248578 predicted 398
3 SASI_Rn02_00248579 predicted 700
4 SASI_Rn02_00248580 predicted 906
5 SASI_Rn02_00248581 predicted 385
6 SASI_Rn02_00248582 predicted 635
7 SASI_Rn02_00248583 predicted 1579
8 SASI_Rn02_00248584 predicted 822
9 SASI_Rn02_00248585 predicted 1583
10 SASI_Rn02_00248586 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426780 predicted 906
2 SASI_Mm02_00426781 predicted 958
3 SASI_Mm01_00222307 predicted 1465
4 SASI_Mm01_00222308 predicted 394
5 SASI_Mm01_00222309 predicted 701
6 SASI_Mm01_00222310 predicted 1283
7 SASI_Mm01_00222311 predicted 1432
8 SASI_Mm02_00426782 predicted 1340
9 SASI_Mm02_00426783 predicted 631
10 SASI_Mm01_00222303 predicted 1510
11 SASI_Mm01_00222302 predicted 1511
12 SASI_Mm01_00222304 predicted 1511
13 SASI_Mm01_00222305 predicted 1500
14 SASI_Mm01_00222306 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435805 predicted 389
2 SASI_Mm02_00435806 predicted 703
3 SASI_Mm02_00435807 predicted 386
4 SASI_Mm02_00435808 predicted 354
5 SASI_Mm02_00435809 predicted 634
6 SASI_Mm02_00435810 predicted 547
7 SASI_Mm02_00435811 predicted 1510
8 SASI_Mm02_00435812 predicted 827
9 SASI_Mm02_00435813 predicted 1498
10 SASI_Mm02_00435814 predicted 748
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152568
NKX6-3 MISSION shRNA Bacterial Glycerol Stock
NK6 homeobox 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152568.2-287s21c1
Sequence:CCGGGAGAACGAGGACGACGAGTACCTCGAGGTACTCGTCGTCCTCGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152568.2-168s21c1
Sequence:CCGGTGTGGTTCCAGAACCGCAGGACTCGAGTCCTGCGGTTCTGGAACCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152568.1-135s1c1
Sequence:CCGGCAGACACTCCTGCATGTCTTTCTCGAGAAAGACATGCAGGAGTGTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152568.1-193s1c1
Sequence:CCGGGTGGCGGAAGAAGAGCGCCCTCTCGAGAGGGCGCTCTTCTTCCGCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152568.1-334s1c1
Sequence:CCGGCGACGAGAAGATCCGCCTGCTCTCGAGAGCAGGCGGATCTTCTCGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152568.1-141s1c1
Sequence:CCGGCTCCTGCATGTCTTTCTGCTTCTCGAGAAGCAGAAAGACATGCAGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152568
NKX6-3 MISSION shRNA shRNA Plasmid DNA
NK6 homeobox 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152568.2-287s21c1
Sequence:CCGGGAGAACGAGGACGACGAGTACCTCGAGGTACTCGTCGTCCTCGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152568.2-168s21c1
Sequence:CCGGTGTGGTTCCAGAACCGCAGGACTCGAGTCCTGCGGTTCTGGAACCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152568.1-135s1c1
Sequence:CCGGCAGACACTCCTGCATGTCTTTCTCGAGAAAGACATGCAGGAGTGTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152568.1-193s1c1
Sequence:CCGGGTGGCGGAAGAAGAGCGCCCTCTCGAGAGGGCGCTCTTCTTCCGCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152568.1-334s1c1
Sequence:CCGGCGACGAGAAGATCCGCCTGCTCTCGAGAGCAGGCGGATCTTCTCGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152568.1-141s1c1
Sequence:CCGGCTCCTGCATGTCTTTCTGCTTCTCGAGAAGCAGAAAGACATGCAGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152568
NKX6-3 MISSION shRNA Lentiviral Transduction Particles
NK6 homeobox 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152568.2-287s21c1
Sequence:CCGGGAGAACGAGGACGACGAGTACCTCGAGGTACTCGTCGTCCTCGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152568.2-168s21c1
Sequence:CCGGTGTGGTTCCAGAACCGCAGGACTCGAGTCCTGCGGTTCTGGAACCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152568.1-135s1c1
Sequence:CCGGCAGACACTCCTGCATGTCTTTCTCGAGAAAGACATGCAGGAGTGTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152568.1-193s1c1
Sequence:CCGGGTGGCGGAAGAAGAGCGCCCTCTCGAGAGGGCGCTCTTCTTCCGCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152568.1-334s1c1
Sequence:CCGGCGACGAGAAGATCCGCCTGCTCTCGAGAGCAGGCGGATCTTCTCGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152568.1-141s1c1
Sequence:CCGGCTCCTGCATGTCTTTCTGCTTCTCGAGAAGCAGAAAGACATGCAGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_486090
NKX6-3 MISSION shRNA Bacterial Glycerol Stock
NK6 homeobox 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486090.3-711s21c1
Sequence:CCGGCTGAGTGACACTATCCACAAGCTCGAGCTTGTGGATAGTGTCACTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486090.3-399s21c1
Sequence:CCGGTACTCGGTGCAGAACTCTTTCCTCGAGGAAAGAGTTCTGCACCGAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486090.3-753s21c1
Sequence:CCGGTTCACGGGCCACCAGATCTTTCTCGAGAAAGATCTGGTGGCCCGTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_486090.3-1833s21c1
Sequence:CCGGGCGAACCCTAGGCAGAATAAGCTCGAGCTTATTCTGCCTAGGGTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486090.3-980s21c1
Sequence:CCGGGAACGAGGACGATGAGTACAACTCGAGTTGTACTCATCGTCCTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_486090
NKX6-3 MISSION shRNA shRNA Plasmid DNA
NK6 homeobox 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486090.3-711s21c1
Sequence:CCGGCTGAGTGACACTATCCACAAGCTCGAGCTTGTGGATAGTGTCACTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486090.3-399s21c1
Sequence:CCGGTACTCGGTGCAGAACTCTTTCCTCGAGGAAAGAGTTCTGCACCGAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486090.3-753s21c1
Sequence:CCGGTTCACGGGCCACCAGATCTTTCTCGAGAAAGATCTGGTGGCCCGTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_486090.3-1833s21c1
Sequence:CCGGGCGAACCCTAGGCAGAATAAGCTCGAGCTTATTCTGCCTAGGGTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486090.3-980s21c1
Sequence:CCGGGAACGAGGACGATGAGTACAACTCGAGTTGTACTCATCGTCCTCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_486090
NKX6-3 MISSION shRNA Lentiviral Transduction Particles
NK6 homeobox 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486090.3-711s21c1
Sequence:CCGGCTGAGTGACACTATCCACAAGCTCGAGCTTGTGGATAGTGTCACTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486090.3-399s21c1
Sequence:CCGGTACTCGGTGCAGAACTCTTTCCTCGAGGAAAGAGTTCTGCACCGAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486090.3-753s21c1
Sequence:CCGGTTCACGGGCCACCAGATCTTTCTCGAGAAAGATCTGGTGGCCCGTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_486090.3-1833s21c1
Sequence:CCGGGCGAACCCTAGGCAGAATAAGCTCGAGCTTATTCTGCCTAGGGTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486090.3-980s21c1
Sequence:CCGGGAACGAGGACGATGAGTACAACTCGAGTTGTACTCATCGTCCTCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029002
NKX6-3 MISSION shRNA Bacterial Glycerol Stock
NK6 homeobox 3
Mouse
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000255501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029002.1-1037s21c1
Sequence:CCGGGGACCAGAGAAGAGGAGTTGGCTCGAGCCAACTCCTCTTCTCTGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029002
NKX6-3 MISSION shRNA shRNA Plasmid DNA
NK6 homeobox 3
Mouse
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000255501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029002.1-1037s21c1
Sequence:CCGGGGACCAGAGAAGAGGAGTTGGCTCGAGCCAACTCCTCTTCTCTGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029002
NKX6-3 MISSION shRNA Lentiviral Transduction Particles
NK6 homeobox 3
Mouse
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000255501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029002.1-1037s21c1
Sequence:CCGGGGACCAGAGAAGAGGAGTTGGCTCGAGCCAACTCCTCTTCTCTGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)