EMAIL THIS PAGE TO A FRIEND

NLE1

notchless homolog 1 (Drosophila)

80 Gene Product Result for
Synonyms: Nle
UniProtKB ID: Q9NVX2, O60868, Q59GJ8, Q9BU54
Gene ID:
Mouse(217011) notchless homolog 1 (Drosophila)
Rat(303372) notchless homolog 1 (Drosophila)
Zebrafish(553606) notchless homolog 1 (Drosophila)
cow(509793) notchless homolog 1 (Drosophila)
Horse(100071653) notchless homolog 1 (Drosophila)
chicken(417613) notchless homolog 1 (Drosophila)
domestic cat(101099003) notchless homolog 1 (Drosophila)
dog(491142) notchless homolog 1 (Drosophila)
sheep(101118199) notchless homolog 1 (Drosophila)
naked mole-rat(101706378) notchless homolog 1 (Drosophila)
Domestic Rabbit(100357680) notchless homolog 1 (Drosophila)
domestic guinea pig(100715514) notchless homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA018807 Anti-NLE1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502250 Anti-NLE1 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018096 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018096 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018096 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014445 Rosetta Predictions human pricing
NM_018096 Rosetta Predictions human pricing
NM_001127534 Rosetta Predictions rat pricing
NM_145431 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215607 predicted 1524
2 SASI_Hs01_00215608 predicted 1962
3 SASI_Hs02_00306550 predicted 1953
4 SASI_Hs01_00215610 predicted 1190
5 SASI_Hs01_00215611 predicted 1076
6 SASI_Hs01_00215612 predicted 2036
7 SASI_Hs01_00215613 predicted 1964
8 SASI_Hs01_00215615 predicted 1426
9 SASI_Hs01_00215616 predicted 1590
10 SASI_Hs02_00306551 predicted 1320
11 SASI_Hs01_00215609 predicted 1379
12 SASI_Hs01_00215614 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118108 predicted 1828
2 SASI_Hs01_00118110 predicted 1826
3 SASI_Hs01_00118111 predicted 1868
4 SASI_Hs01_00118112 predicted 1447
5 SASI_Hs01_00118113 predicted 1702
6 SASI_Hs02_00351279 predicted 475
7 SASI_Hs01_00118114 predicted 502
8 SASI_Hs01_00118115 predicted 1861
9 SASI_Hs01_00118116 predicted 1678
10 SASI_Hs01_00118117 predicted 980
11 SASI_Hs01_00118109 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254093 predicted 329
2 SASI_Rn02_00254094 predicted 1036
3 SASI_Rn02_00254095 predicted 1326
4 SASI_Rn02_00254096 predicted 530
5 SASI_Rn02_00254097 predicted 316
6 SASI_Rn02_00254098 predicted 687
7 SASI_Rn02_00254099 predicted 669
8 SASI_Rn02_00254100 predicted 1403
9 SASI_Rn02_00254101 predicted 859
10 SASI_Rn02_00254102 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178865 predicted 707
2 SASI_Mm01_00178867 predicted 864
3 SASI_Mm01_00178869 predicted 896
4 SASI_Mm02_00340791 predicted 703
5 SASI_Mm01_00178870 predicted 1361
6 SASI_Mm01_00178871 predicted 1136
7 SASI_Mm01_00178872 predicted 1296
8 SASI_Mm01_00178873 predicted 894
9 SASI_Mm02_00340792 predicted 1293
10 SASI_Mm01_00178874 predicted 366
11 SASI_Mm01_00178866 predicted 1423
12 SASI_Mm01_00178868 predicted 958
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145431
VALIDATED
NLE1 MISSION shRNA Bacterial Glycerol Stock
notchless homolog 1 (Drosophila)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145431.1-1593s1c1
Sequence:CCGGTGTGTGACAGTCAGGACATTACTCGAGTAATGTCCTGACTGTCACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145431.1-469s1c1
Sequence:CCGGACACCGCACTTCACATGCAAACTCGAGTTTGCATGTGAAGTGCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145431.1-804s1c1
Sequence:CCGGGCTTCTATATTCTGCTTCCCACTCGAGTGGGAAGCAGAATATAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145431.1-1071s1c1
Sequence:CCGGCTCAGACGACTTCACCTTATTCTCGAGAATAAGGTGAAGTCGTCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145431.1-1396s1c1
Sequence:CCGGGCCGATGAGGTATATGCTGTTCTCGAGAACAGCATATACCTCATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-1081s21c1
Sequence:CCGGTCAGACGACTTCACCTTATTCCTCGAGGAATAAGGTGAAGTCGTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-1467s21c1
Sequence:CCGGAGACAAGTGCCTCCGGATATGCTCGAGCATATCCGGAGGCACTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-506s21c1
Sequence:CCGGGGCACTGGGTCCTTAGCATATCTCGAGATATGCTAAGGACCCAGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145431.2-1601s21c1
Sequence:CCGGGTGTGTGACAGTCAGGACATTCTCGAGAATGTCCTGACTGTCACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-1305s21c1
Sequence:CCGGGTCAGCTGACAGCCGACTATTCTCGAGAATAGTCGGCTGTCAGCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-227s21c1
Sequence:CCGGACGTCCACGATGCTGAGATTGCTCGAGCAATCTCAGCATCGTGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-1207s21c1
Sequence:CCGGGCCTCCTTCGACAAGTCTATCCTCGAGGATAGACTTGTCGAAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-1492s21c1
Sequence:CCGGAGATGACTCCACAGCTTATTGCTCGAGCAATAAGCTGTGGAGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145431
VALIDATED
NLE1 MISSION shRNA shRNA Plasmid DNA
notchless homolog 1 (Drosophila)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145431.1-1593s1c1
Sequence:CCGGTGTGTGACAGTCAGGACATTACTCGAGTAATGTCCTGACTGTCACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145431.1-469s1c1
Sequence:CCGGACACCGCACTTCACATGCAAACTCGAGTTTGCATGTGAAGTGCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145431.1-804s1c1
Sequence:CCGGGCTTCTATATTCTGCTTCCCACTCGAGTGGGAAGCAGAATATAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145431.1-1071s1c1
Sequence:CCGGCTCAGACGACTTCACCTTATTCTCGAGAATAAGGTGAAGTCGTCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145431.1-1396s1c1
Sequence:CCGGGCCGATGAGGTATATGCTGTTCTCGAGAACAGCATATACCTCATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-1081s21c1
Sequence:CCGGTCAGACGACTTCACCTTATTCCTCGAGGAATAAGGTGAAGTCGTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-1467s21c1
Sequence:CCGGAGACAAGTGCCTCCGGATATGCTCGAGCATATCCGGAGGCACTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-506s21c1
Sequence:CCGGGGCACTGGGTCCTTAGCATATCTCGAGATATGCTAAGGACCCAGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145431.2-1601s21c1
Sequence:CCGGGTGTGTGACAGTCAGGACATTCTCGAGAATGTCCTGACTGTCACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-1305s21c1
Sequence:CCGGGTCAGCTGACAGCCGACTATTCTCGAGAATAGTCGGCTGTCAGCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-227s21c1
Sequence:CCGGACGTCCACGATGCTGAGATTGCTCGAGCAATCTCAGCATCGTGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-1207s21c1
Sequence:CCGGGCCTCCTTCGACAAGTCTATCCTCGAGGATAGACTTGTCGAAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-1492s21c1
Sequence:CCGGAGATGACTCCACAGCTTATTGCTCGAGCAATAAGCTGTGGAGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145431
VALIDATED
NLE1 MISSION shRNA Lentiviral Transduction Particles
notchless homolog 1 (Drosophila)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145431.1-1593s1c1
Sequence:CCGGTGTGTGACAGTCAGGACATTACTCGAGTAATGTCCTGACTGTCACACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145431.1-469s1c1
Sequence:CCGGACACCGCACTTCACATGCAAACTCGAGTTTGCATGTGAAGTGCGGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145431.1-804s1c1
Sequence:CCGGGCTTCTATATTCTGCTTCCCACTCGAGTGGGAAGCAGAATATAGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145431.1-1071s1c1
Sequence:CCGGCTCAGACGACTTCACCTTATTCTCGAGAATAAGGTGAAGTCGTCTGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145431.1-1396s1c1
Sequence:CCGGGCCGATGAGGTATATGCTGTTCTCGAGAACAGCATATACCTCATCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-1081s21c1
Sequence:CCGGTCAGACGACTTCACCTTATTCCTCGAGGAATAAGGTGAAGTCGTCTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-1467s21c1
Sequence:CCGGAGACAAGTGCCTCCGGATATGCTCGAGCATATCCGGAGGCACTTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-506s21c1
Sequence:CCGGGGCACTGGGTCCTTAGCATATCTCGAGATATGCTAAGGACCCAGTGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145431.2-1601s21c1
Sequence:CCGGGTGTGTGACAGTCAGGACATTCTCGAGAATGTCCTGACTGTCACACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-1305s21c1
Sequence:CCGGGTCAGCTGACAGCCGACTATTCTCGAGAATAGTCGGCTGTCAGCTGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-227s21c1
Sequence:CCGGACGTCCACGATGCTGAGATTGCTCGAGCAATCTCAGCATCGTGGACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-1207s21c1
Sequence:CCGGGCCTCCTTCGACAAGTCTATCCTCGAGGATAGACTTGTCGAAGGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145431.2-1492s21c1
Sequence:CCGGAGATGACTCCACAGCTTATTGCTCGAGCAATAAGCTGTGGAGTCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018096
VALIDATED
NLE1 MISSION shRNA Bacterial Glycerol Stock
notchless homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018096.2-262s1c1
Sequence:CCGGGACAGAGAAGGTCCTAGACATCTCGAGATGTCTAGGACCTTCTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018096.2-817s1c1
Sequence:CCGGCATCAAAGTCTGGAGAGCTCACTCGAGTGAGCTCTCCAGACTTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018096.2-451s1c1
Sequence:CCGGGACACCACATTTCACATGCAACTCGAGTTGCATGTGAAATGTGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018096.2-275s1c1
Sequence:CCGGCTAGACATCATCTACCAGCCACTCGAGTGGCTGGTAGATGATGTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018096.3-466s21c1
Sequence:CCGGGACACCACATTTCACATGCAACTCGAGTTGCATGTGAAATGTGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018096.3-277s21c1
Sequence:CCGGGACAGAGAAGGTCCTAGACATCTCGAGATGTCTAGGACCTTCTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018096.3-1069s21c1
Sequence:CCGGCTCCGACGACTTCACCTTATTCTCGAGAATAAGGTGAAGTCGTCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018096.3-495s21c1
Sequence:CCGGGACACTGGGTCCTTAGTATATCTCGAGATATACTAAGGACCCAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018096.3-1825s21c1
Sequence:CCGGCCAGGTTCTATGACCAAATAACTCGAGTTATTTGGTCATAGAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018096
VALIDATED
NLE1 MISSION shRNA shRNA Plasmid DNA
notchless homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018096.2-262s1c1
Sequence:CCGGGACAGAGAAGGTCCTAGACATCTCGAGATGTCTAGGACCTTCTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018096.2-817s1c1
Sequence:CCGGCATCAAAGTCTGGAGAGCTCACTCGAGTGAGCTCTCCAGACTTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018096.2-451s1c1
Sequence:CCGGGACACCACATTTCACATGCAACTCGAGTTGCATGTGAAATGTGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018096.2-275s1c1
Sequence:CCGGCTAGACATCATCTACCAGCCACTCGAGTGGCTGGTAGATGATGTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018096.3-466s21c1
Sequence:CCGGGACACCACATTTCACATGCAACTCGAGTTGCATGTGAAATGTGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018096.3-277s21c1
Sequence:CCGGGACAGAGAAGGTCCTAGACATCTCGAGATGTCTAGGACCTTCTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018096.3-1069s21c1
Sequence:CCGGCTCCGACGACTTCACCTTATTCTCGAGAATAAGGTGAAGTCGTCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018096.3-495s21c1
Sequence:CCGGGACACTGGGTCCTTAGTATATCTCGAGATATACTAAGGACCCAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018096.3-1825s21c1
Sequence:CCGGCCAGGTTCTATGACCAAATAACTCGAGTTATTTGGTCATAGAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018096
VALIDATED
NLE1 MISSION shRNA Lentiviral Transduction Particles
notchless homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018096.2-262s1c1
Sequence:CCGGGACAGAGAAGGTCCTAGACATCTCGAGATGTCTAGGACCTTCTCTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018096.2-817s1c1
Sequence:CCGGCATCAAAGTCTGGAGAGCTCACTCGAGTGAGCTCTCCAGACTTTGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018096.2-451s1c1
Sequence:CCGGGACACCACATTTCACATGCAACTCGAGTTGCATGTGAAATGTGGTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018096.2-275s1c1
Sequence:CCGGCTAGACATCATCTACCAGCCACTCGAGTGGCTGGTAGATGATGTCTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018096.3-466s21c1
Sequence:CCGGGACACCACATTTCACATGCAACTCGAGTTGCATGTGAAATGTGGTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018096.3-277s21c1
Sequence:CCGGGACAGAGAAGGTCCTAGACATCTCGAGATGTCTAGGACCTTCTCTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018096.3-1069s21c1
Sequence:CCGGCTCCGACGACTTCACCTTATTCTCGAGAATAAGGTGAAGTCGTCGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018096.3-495s21c1
Sequence:CCGGGACACTGGGTCCTTAGTATATCTCGAGATATACTAAGGACCCAGTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018096.3-1825s21c1
Sequence:CCGGCCAGGTTCTATGACCAAATAACTCGAGTTATTTGGTCATAGAACCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)