EMAIL THIS PAGE TO A FRIEND

NLGN3

neuroligin 3

118 Gene Product Result for
Synonyms: HNL3
Gene ID:
Human(54413) Summary: This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. Mutations in this gene may be associated with autism and Asperger syndrome. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Oct 2009]
Mouse(245537) neuroligin 3
Rat(171297) neuroligin 3
chicken(770104) neuroligin 3
cow(511251) neuroligin 3
Horse(100055823) neuroligin 3
dog(491947) neuroligin 3
sheep(101103785) neuroligin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500687 Anti-Neuroligin 3 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rat, canine
ELISA, western blot pricing
SAB1407543 Anti-NLGN3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA003183 Anti-NLGN3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB1410991 Anti-NLGN3 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB5201617 Monoclonal Anti-Neuroligin - Alkaline Phosphatase antibody produced in mouse clone S110-29, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201618 Monoclonal Anti-Neuroligin - Apc antibody produced in mouse clone S110-29, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201609 Monoclonal Anti-Neuroligin - Atto 390 antibody produced in mouse clone S110-29, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201610 Monoclonal Anti-Neuroligin - Atto 488 antibody produced in mouse clone S110-29, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201611 Monoclonal Anti-Neuroligin - Atto 565 antibody produced in mouse clone S110-29, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201612 Monoclonal Anti-Neuroligin - Atto 594 antibody produced in mouse clone S110-29, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201613 Monoclonal Anti-Neuroligin - Atto 633 antibody produced in mouse clone S110-29, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201614 Monoclonal Anti-Neuroligin - Atto 655 antibody produced in mouse clone S110-29, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201615 Monoclonal Anti-Neuroligin - Atto 680 antibody produced in mouse clone S110-29, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201616 Monoclonal Anti-Neuroligin - Atto 700 antibody produced in mouse clone S110-29, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201619 Monoclonal Anti-Neuroligin - Biotin antibody produced in mouse clone S110-29, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201620 Monoclonal Anti-Neuroligin - Fitc antibody produced in mouse clone S110-29, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201621 Monoclonal Anti-Neuroligin - Hrp antibody produced in mouse clone S110-29, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201622 Monoclonal Anti-Neuroligin - Pe/Atto 594 antibody produced in mouse clone S110-29, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201623 Monoclonal Anti-Neuroligin - Percp antibody produced in mouse clone S110-29, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201624 Monoclonal Anti-Neuroligin - Rpe antibody produced in mouse clone S110-29, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201625 Monoclonal Anti-Neuroligin - Streptavidin antibody produced in mouse clone S110-29, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201608 Monoclonal Anti-Neuroligin 3 antibody produced in mouse clone S110-29, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
WH0054413M2 Monoclonal Anti-NLGN3 antibody produced in mouse clone 2A6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018977 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018977 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018977 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063861 MISSION® esiRNA esiRNA human NLGN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018977 Rosetta Predictions human pricing
NM_134336 Rosetta Predictions rat pricing
NM_172932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159324 predicted 1735
2 SASI_Hs01_00159325 predicted 909
3 SASI_Hs01_00159326 predicted 1207
4 SASI_Hs02_00352472 predicted 1168
5 SASI_Hs01_00159327 predicted 2347
6 SASI_Hs01_00159328 predicted 2140
7 SASI_Hs01_00159329 predicted 834
8 SASI_Hs01_00159331 predicted 837
9 SASI_Hs01_00159332 predicted 2177
10 SASI_Hs02_00352473 predicted 1771
11 SASI_Hs01_00159323 predicted 1813
12 SASI_Hs01_00159330 predicted 1562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043491 predicted 2402
2 SASI_Rn01_00043492 predicted 1231
3 SASI_Rn01_00043493 predicted 677
4 SASI_Rn01_00043494 predicted 1059
5 SASI_Rn01_00043495 predicted 1247
6 SASI_Rn01_00043496 predicted 1303
7 SASI_Rn01_00043497 predicted 889
8 SASI_Rn01_00043498 predicted 2262
9 SASI_Rn01_00043499 predicted 2115
10 SASI_Rn01_00043500 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052430 predicted 651
2 SASI_Mm01_00052431 predicted 1150
3 SASI_Mm01_00052432 predicted 867
4 SASI_Mm01_00052433 predicted 1213
5 SASI_Mm01_00052434 predicted 807
6 SASI_Mm01_00052435 predicted 2183
7 SASI_Mm01_00052437 predicted 2395
8 SASI_Mm01_00052438 predicted 1746
9 SASI_Mm02_00344938 predicted 1530
10 SASI_Mm02_00344939 predicted 2501
11 SASI_Mm01_00052429 predicted 1348
12 SASI_Mm01_00052436 predicted 2044
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018977
NLGN3 MISSION shRNA Bacterial Glycerol Stock
neuroligin 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018977.3-3058s21c1
Sequence:CCGGGCAGATGAGTCCTCGGTAAACCTCGAGGTTTACCGAGGACTCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018977.3-3216s21c1
Sequence:CCGGTCCAGACTTGGGAGCTTTAAACTCGAGTTTAAAGCTCCCAAGTCTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018977.3-2101s21c1
Sequence:CCGGACCAAGGGTCCGAGATCATTACTCGAGTAATGATCTCGGACCCTTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018977.3-812s21c1
Sequence:CCGGGGCGAGGACTTAGCGGATAATCTCGAGATTATCCGCTAAGTCCTCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018977.1-1238s1c1
Sequence:CCGGGCAGACAAAGTGGGCTGTAATCTCGAGATTACAGCCCACTTTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018977.1-907s1c1
Sequence:CCGGCGCCAGTTATGGCAATGTCATCTCGAGATGACATTGCCATAACTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018977.1-419s1c1
Sequence:CCGGCCCACAGTCAACACTCACTTTCTCGAGAAAGTGAGTGTTGACTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018977.1-2419s1c1
Sequence:CCGGCCTCTACTACCGTAAGGACAACTCGAGTTGTCCTTACGGTAGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018977.1-2339s1c1
Sequence:CCGGCGTGACTACTCCACTGAATTACTCGAGTAATTCAGTGGAGTAGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018977
NLGN3 MISSION shRNA shRNA Plasmid DNA
neuroligin 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018977.3-3058s21c1
Sequence:CCGGGCAGATGAGTCCTCGGTAAACCTCGAGGTTTACCGAGGACTCATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018977.3-3216s21c1
Sequence:CCGGTCCAGACTTGGGAGCTTTAAACTCGAGTTTAAAGCTCCCAAGTCTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018977.3-2101s21c1
Sequence:CCGGACCAAGGGTCCGAGATCATTACTCGAGTAATGATCTCGGACCCTTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018977.3-812s21c1
Sequence:CCGGGGCGAGGACTTAGCGGATAATCTCGAGATTATCCGCTAAGTCCTCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018977.1-1238s1c1
Sequence:CCGGGCAGACAAAGTGGGCTGTAATCTCGAGATTACAGCCCACTTTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018977.1-907s1c1
Sequence:CCGGCGCCAGTTATGGCAATGTCATCTCGAGATGACATTGCCATAACTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018977.1-419s1c1
Sequence:CCGGCCCACAGTCAACACTCACTTTCTCGAGAAAGTGAGTGTTGACTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018977.1-2419s1c1
Sequence:CCGGCCTCTACTACCGTAAGGACAACTCGAGTTGTCCTTACGGTAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018977.1-2339s1c1
Sequence:CCGGCGTGACTACTCCACTGAATTACTCGAGTAATTCAGTGGAGTAGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018977
NLGN3 MISSION shRNA Lentiviral Transduction Particles
neuroligin 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018977.3-3058s21c1
Sequence:CCGGGCAGATGAGTCCTCGGTAAACCTCGAGGTTTACCGAGGACTCATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018977.3-3216s21c1
Sequence:CCGGTCCAGACTTGGGAGCTTTAAACTCGAGTTTAAAGCTCCCAAGTCTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018977.3-2101s21c1
Sequence:CCGGACCAAGGGTCCGAGATCATTACTCGAGTAATGATCTCGGACCCTTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018977.3-812s21c1
Sequence:CCGGGGCGAGGACTTAGCGGATAATCTCGAGATTATCCGCTAAGTCCTCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018977.1-1238s1c1
Sequence:CCGGGCAGACAAAGTGGGCTGTAATCTCGAGATTACAGCCCACTTTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018977.1-907s1c1
Sequence:CCGGCGCCAGTTATGGCAATGTCATCTCGAGATGACATTGCCATAACTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018977.1-419s1c1
Sequence:CCGGCCCACAGTCAACACTCACTTTCTCGAGAAAGTGAGTGTTGACTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018977.1-2419s1c1
Sequence:CCGGCCTCTACTACCGTAAGGACAACTCGAGTTGTCCTTACGGTAGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018977.1-2339s1c1
Sequence:CCGGCGTGACTACTCCACTGAATTACTCGAGTAATTCAGTGGAGTAGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172932
NLGN3 MISSION shRNA Bacterial Glycerol Stock
neuroligin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172932.1-1293s1c1
Sequence:CCGGGAGCTGGTAGAACAGGACATTCTCGAGAATGTCCTGTTCTACCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172932.1-1527s1c1
Sequence:CCGGGTGGACAATCTGTATGGCTATCTCGAGATAGCCATACAGATTGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172932.1-2647s1c1
Sequence:CCGGCCATCACTATGATTCCTAATTCTCGAGAATTAGGAATCATAGTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172932.1-2369s1c1
Sequence:CCGGCCTCCTGTTTCTCAATGTGTTCTCGAGAACACATTGAGAAACAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172932.1-2332s1c1
Sequence:CCGGCCACTGAATTAAGTGTCACTACTCGAGTAGTGACACTTAATTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172932
NLGN3 MISSION shRNA shRNA Plasmid DNA
neuroligin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172932.1-1293s1c1
Sequence:CCGGGAGCTGGTAGAACAGGACATTCTCGAGAATGTCCTGTTCTACCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172932.1-1527s1c1
Sequence:CCGGGTGGACAATCTGTATGGCTATCTCGAGATAGCCATACAGATTGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172932.1-2647s1c1
Sequence:CCGGCCATCACTATGATTCCTAATTCTCGAGAATTAGGAATCATAGTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172932.1-2369s1c1
Sequence:CCGGCCTCCTGTTTCTCAATGTGTTCTCGAGAACACATTGAGAAACAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172932.1-2332s1c1
Sequence:CCGGCCACTGAATTAAGTGTCACTACTCGAGTAGTGACACTTAATTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172932
NLGN3 MISSION shRNA Lentiviral Transduction Particles
neuroligin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172932.1-1293s1c1
Sequence:CCGGGAGCTGGTAGAACAGGACATTCTCGAGAATGTCCTGTTCTACCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172932.1-1527s1c1
Sequence:CCGGGTGGACAATCTGTATGGCTATCTCGAGATAGCCATACAGATTGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172932.1-2647s1c1
Sequence:CCGGCCATCACTATGATTCCTAATTCTCGAGAATTAGGAATCATAGTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172932.1-2369s1c1
Sequence:CCGGCCTCCTGTTTCTCAATGTGTTCTCGAGAACACATTGAGAAACAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172932.1-2332s1c1
Sequence:CCGGCCACTGAATTAAGTGTCACTACTCGAGTAGTGACACTTAATTCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)