EMAIL THIS PAGE TO A FRIEND

NLGN4X

neuroligin 4, X-linked

110 Gene Product Result for
Synonyms: ASPGX2 AUTSX2 HLNX HNL4X NLGN4
UniProtKB ID: Q8N0W4, Q6UX10, Q9ULG0
Gene ID:
Human(57502) Summary: This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. The encoded protein interacts with discs, large (Drosophila) homolog 4 (DLG4). Mutations in this gene have been associated with autism and Asperger syndrome. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
sheep(101117049) neuroligin 4, X-linked
naked mole-rat(101715794) neuroligin 4, X-linked
domestic guinea pig(100714631) neuroligin 4, X-linked
chicken(428006) neuroligin 4, X-linked
cow(101909915) neuroligin 4, X-linked
Horse(100050709) neuroligin 4, X-linked
domestic cat(101082213) neuroligin 4, X-linked
dog(607406) neuroligin 4, X-linked
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020742 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020742 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020742 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020742 Rosetta Predictions human pricing
NM_181332 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015014 predicted 2224
2 SASI_Hs01_00015015 predicted 848
3 SASI_Hs01_00015016 predicted 951
4 SASI_Hs01_00015017 predicted 835
5 SASI_Hs01_00015018 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108721 predicted 2197
2 SASI_Hs01_00108722 predicted 808
3 SASI_Hs01_00108723 predicted 911
4 SASI_Hs01_00108724 predicted 807
5 SASI_Hs01_00108725 predicted 876
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020742
NLGN4X MISSION shRNA Bacterial Glycerol Stock
neuroligin 4, X-linked
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000047125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020742.2-924s1c1
Sequence:CCGGCCCACGGAAGATGATATTCATCTCGAGATGAATATCATCTTCCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020742.2-2469s1c1
Sequence:CCGGCGAGATTATTCCACCGAATTACTCGAGTAATTCGGTGGAATAATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020742.2-1074s1c1
Sequence:CCGGCGTCTGGGAATACTAGGGTTTCTCGAGAAACCCTAGTATTCCCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020742.2-2255s1c1
Sequence:CCGGGCACAACTTGAACGAGATATTCTCGAGAATATCTCGTTCAAGTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020742
NLGN4X MISSION shRNA shRNA Plasmid DNA
neuroligin 4, X-linked
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000047125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020742.2-924s1c1
Sequence:CCGGCCCACGGAAGATGATATTCATCTCGAGATGAATATCATCTTCCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020742.2-2469s1c1
Sequence:CCGGCGAGATTATTCCACCGAATTACTCGAGTAATTCGGTGGAATAATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020742.2-1074s1c1
Sequence:CCGGCGTCTGGGAATACTAGGGTTTCTCGAGAAACCCTAGTATTCCCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020742.2-2255s1c1
Sequence:CCGGGCACAACTTGAACGAGATATTCTCGAGAATATCTCGTTCAAGTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020742
NLGN4X MISSION shRNA Lentiviral Transduction Particles
neuroligin 4, X-linked
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000047125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020742.2-924s1c1
Sequence:CCGGCCCACGGAAGATGATATTCATCTCGAGATGAATATCATCTTCCGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020742.2-2469s1c1
Sequence:CCGGCGAGATTATTCCACCGAATTACTCGAGTAATTCGGTGGAATAATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020742.2-1074s1c1
Sequence:CCGGCGTCTGGGAATACTAGGGTTTCTCGAGAAACCCTAGTATTCCCAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020742.2-2255s1c1
Sequence:CCGGGCACAACTTGAACGAGATATTCTCGAGAATATCTCGTTCAAGTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)