EMAIL THIS PAGE TO A FRIEND

NLGN4Y

neuroligin 4, Y-linked

84 Gene Product Result for
UniProtKB ID: Q8NFZ3, F5H6W0, Q14D08, Q7Z3T5, Q8N5B6, Q9Y2F8
Gene ID:
Human(22829) Summary: This gene encodes a type I membrane protein that belongs to the family of neuroligins, which are cell adhesion molecules present at the postsynaptic side of the synapse, and may be essential for the formation of functional synapses. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Mar 2011]
cow(100300059) neuroligin 4, Y-linked-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014893 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014893 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014893 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148881 MISSION® esiRNA esiRNA human NLGN4Y (esiRNA3) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014893 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088169 predicted 1418
2 SASI_Hs01_00088170 predicted 2977
3 SASI_Hs01_00088171 predicted 502
4 SASI_Hs01_00088172 predicted 917
5 SASI_Hs01_00088168 predicted 540
6 SASI_Hs01_00088173 predicted 1994
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014893
NLGN4Y MISSION shRNA Bacterial Glycerol Stock
neuroligin 4, Y-linked
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014893.2-3495s1c1
Sequence:CCGGGCCAGCCTGAACTATATTTAACTCGAGTTAAATATAGTTCAGGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014893.2-520s1c1
Sequence:CCGGCTCTGTCTGTGTCATGTTAAACTCGAGTTTAACATGACACAGACAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014893.2-1050s1c1
Sequence:CCGGGCTATGGGAACGTCATCGTTACTCGAGTAACGATGACGTTCCCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014893.2-814s1c1
Sequence:CCGGCCTGGATGAAAGATTCTTATTCTCGAGAATAAGAATCTTTCATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014893.2-542s1c1
Sequence:CCGGTCCAATGTTCTTCTGTGGATACTCGAGTATCCACAGAAGAACATTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014893
NLGN4Y MISSION shRNA shRNA Plasmid DNA
neuroligin 4, Y-linked
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014893.2-3495s1c1
Sequence:CCGGGCCAGCCTGAACTATATTTAACTCGAGTTAAATATAGTTCAGGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014893.2-520s1c1
Sequence:CCGGCTCTGTCTGTGTCATGTTAAACTCGAGTTTAACATGACACAGACAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014893.2-1050s1c1
Sequence:CCGGGCTATGGGAACGTCATCGTTACTCGAGTAACGATGACGTTCCCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014893.2-814s1c1
Sequence:CCGGCCTGGATGAAAGATTCTTATTCTCGAGAATAAGAATCTTTCATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014893.2-542s1c1
Sequence:CCGGTCCAATGTTCTTCTGTGGATACTCGAGTATCCACAGAAGAACATTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014893
NLGN4Y MISSION shRNA Lentiviral Transduction Particles
neuroligin 4, Y-linked
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014893.2-3495s1c1
Sequence:CCGGGCCAGCCTGAACTATATTTAACTCGAGTTAAATATAGTTCAGGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014893.2-520s1c1
Sequence:CCGGCTCTGTCTGTGTCATGTTAAACTCGAGTTTAACATGACACAGACAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014893.2-1050s1c1
Sequence:CCGGGCTATGGGAACGTCATCGTTACTCGAGTAACGATGACGTTCCCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014893.2-814s1c1
Sequence:CCGGCCTGGATGAAAGATTCTTATTCTCGAGAATAAGAATCTTTCATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014893.2-542s1c1
Sequence:CCGGTCCAATGTTCTTCTGTGGATACTCGAGTATCCACAGAAGAACATTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)