EMAIL THIS PAGE TO A FRIEND

NLK

nemo-like kinase

208 Gene Product Result for
UniProtKB ID: Q9UBE8, B2RCX1, Q2PNI9, Q6P2A3
Gene ID:
Mouse(18099) nemo like kinase
Rat(497961) nemo like kinase
chicken(417669) nemo-like kinase
domestic cat(101080751) nemo-like kinase
cow(507204) nemo-like kinase
Horse(100058876) nemo-like kinase
dog(491160) nemo-like kinase
naked mole-rat(101701893) nemo-like kinase
Domestic Rabbit(100348930) nemo-like kinase
sheep(101103076) nemo-like kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
MABN691 Anti-GPI Antibody, clone 1B7D7 Anti-GPI Antibody, clone 1B7D7 is a highly specific mouse monoclonal antibody, that targets Glucose-6-phosphate isomerase & has been tested in western blotting, IHC & Immunofluorescence. human, rat
immunofluorescence, immunohistochemistry, western blot pricing
N8288 Anti-NLK (441-455) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1407512 Anti-NLK antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA018192 Anti-NLK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
HPA056511 Anti-NLK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, immunohistochemistry pricing
WH0051701M1 Monoclonal Anti-NLK antibody produced in mouse clone 1C1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
14-545-M NEK2 Protein, active, 10 µg Active, N-terminal His6-tagged, recombinant, full-length, human NEK2, for use in Kinase Assays. activity assay pricing
14-676-M NLK Protein, active, 10 µg Active, N-terminal 6His-tagged, recombinant, human NLK, amino acids 121-end, for use in Kinase Assays. activity assay pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008702 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008702 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008702 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016231 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016231 Rosetta Predictions human pricing
XM_001080888 Rosetta Predictions rat pricing
XM_573152 Rosetta Predictions rat pricing
NM_008702 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074881 predicted 1150
2 SASI_Hs01_00074882 predicted 724
3 SASI_Hs01_00074883 predicted 1108
4 SASI_Hs01_00074884 predicted 670
5 SASI_Hs01_00074885 predicted 1552
6 SASI_Hs01_00074886 predicted 1271
7 SASI_Hs01_00074888 predicted 795
8 SASI_Hs02_00349098 predicted 1032
9 SASI_Hs01_00074890 predicted 1624
10 SASI_Hs02_00349099 predicted 1478
11 SASI_Hs01_00074887 predicted 1281
12 SASI_Hs01_00074889 predicted 2089
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369720 predicted 1952
2 SASI_Rn02_00369721 predicted 1431
3 SASI_Rn02_00369722 predicted 1742
4 SASI_Rn02_00369723 predicted 2203
5 SASI_Rn02_00369724 predicted 1322
6 SASI_Rn02_00369725 predicted 1466
7 SASI_Rn02_00369726 predicted 1284
8 SASI_Rn02_00369727 predicted 1499
9 SASI_Rn02_00369728 predicted 1979
10 SASI_Rn02_00369729 predicted 2255
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399894 predicted 2246
2 SASI_Rn02_00399895 predicted 1727
3 SASI_Rn02_00399896 predicted 2032
4 SASI_Rn02_00399897 predicted 2496
5 SASI_Rn02_00399898 predicted 1616
6 SASI_Rn02_00399899 predicted 1758
7 SASI_Rn02_00399900 predicted 1576
8 SASI_Rn02_00399901 predicted 1793
9 SASI_Rn02_00399902 predicted 2268
10 SASI_Rn02_00399903 predicted 2553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061229 predicted 1671
2 SASI_Mm01_00061230 predicted 2096
3 SASI_Mm01_00061231 predicted 2516
4 SASI_Mm01_00061232 predicted 2498
5 SASI_Mm01_00061233 predicted 1608
6 SASI_Mm02_00314518 predicted 1511
7 SASI_Mm01_00061235 predicted 1708
8 SASI_Mm01_00061236 predicted 2452
9 SASI_Mm01_00061237 predicted 1524
10 SASI_Mm01_00061238 predicted 1980
11 SASI_Mm01_00061234 predicted 2710
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008702
VALIDATED
NLK MISSION shRNA Bacterial Glycerol Stock
nemo-like kinase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008702.2-2400s1c1
Sequence:CCGGGCTGAGATACCATACGTGTATCTCGAGATACACGTATGGTATCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008702.3-2156s21c1
Sequence:CCGGGAGCTACTGGGCCGAAGAATACTCGAGTATTCTTCGGCCCAGTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008702.2-1817s1c1
Sequence:CCGGGCTCGGATCATGTCAAAGTTTCTCGAGAAACTTTGACATGATCCGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008702.2-1524s1c1
Sequence:CCGGGCCGGATAGACCAATTGGATACTCGAGTATCCAATTGGTCTATCCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008702.2-2052s1c1
Sequence:CCGGCCGTCATTACAGCAATGCTATCTCGAGATAGCATTGCTGTAATGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008702.2-2529s1c1
Sequence:CCGGCCGACAGGTTAAAGAAATTATCTCGAGATAATTTCTTTAACCTGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008702.3-1822s21c1
Sequence:GTACCGGGATGCAGAGTGATCTACATAACTCGAGTTATGTAGATCACTCTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008702.3-3741s21c1
Sequence:CCGGTGAGATGTCACAGTAGTAAATCTCGAGATTTACTACTGTGACATCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008702.3-2029s21c1
Sequence:CCGGATTGGATGAATCCCGTCATATCTCGAGATATGACGGGATTCATCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008702.3-1774s21c1
Sequence:CCGGACCTCCACACATTGACTATTTCTCGAGAAATAGTCAATGTGTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008702
VALIDATED
NLK MISSION shRNA shRNA Plasmid DNA
nemo-like kinase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008702.2-2400s1c1
Sequence:CCGGGCTGAGATACCATACGTGTATCTCGAGATACACGTATGGTATCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008702.3-2156s21c1
Sequence:CCGGGAGCTACTGGGCCGAAGAATACTCGAGTATTCTTCGGCCCAGTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008702.2-1817s1c1
Sequence:CCGGGCTCGGATCATGTCAAAGTTTCTCGAGAAACTTTGACATGATCCGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008702.2-1524s1c1
Sequence:CCGGGCCGGATAGACCAATTGGATACTCGAGTATCCAATTGGTCTATCCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008702.2-2052s1c1
Sequence:CCGGCCGTCATTACAGCAATGCTATCTCGAGATAGCATTGCTGTAATGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008702.2-2529s1c1
Sequence:CCGGCCGACAGGTTAAAGAAATTATCTCGAGATAATTTCTTTAACCTGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008702.3-1822s21c1
Sequence:GTACCGGGATGCAGAGTGATCTACATAACTCGAGTTATGTAGATCACTCTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008702.3-3741s21c1
Sequence:CCGGTGAGATGTCACAGTAGTAAATCTCGAGATTTACTACTGTGACATCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008702.3-2029s21c1
Sequence:CCGGATTGGATGAATCCCGTCATATCTCGAGATATGACGGGATTCATCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008702.3-1774s21c1
Sequence:CCGGACCTCCACACATTGACTATTTCTCGAGAAATAGTCAATGTGTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008702
VALIDATED
NLK MISSION shRNA Lentiviral Transduction Particles
nemo-like kinase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008702.2-2400s1c1
Sequence:CCGGGCTGAGATACCATACGTGTATCTCGAGATACACGTATGGTATCTCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008702.3-2156s21c1
Sequence:CCGGGAGCTACTGGGCCGAAGAATACTCGAGTATTCTTCGGCCCAGTAGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008702.2-1817s1c1
Sequence:CCGGGCTCGGATCATGTCAAAGTTTCTCGAGAAACTTTGACATGATCCGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008702.2-1524s1c1
Sequence:CCGGGCCGGATAGACCAATTGGATACTCGAGTATCCAATTGGTCTATCCGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008702.2-2052s1c1
Sequence:CCGGCCGTCATTACAGCAATGCTATCTCGAGATAGCATTGCTGTAATGACGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008702.2-2529s1c1
Sequence:CCGGCCGACAGGTTAAAGAAATTATCTCGAGATAATTTCTTTAACCTGTCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008702.3-1822s21c1
Sequence:GTACCGGGATGCAGAGTGATCTACATAACTCGAGTTATGTAGATCACTCTGCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008702.3-3741s21c1
Sequence:CCGGTGAGATGTCACAGTAGTAAATCTCGAGATTTACTACTGTGACATCTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008702.3-2029s21c1
Sequence:CCGGATTGGATGAATCCCGTCATATCTCGAGATATGACGGGATTCATCCAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008702.3-1774s21c1
Sequence:CCGGACCTCCACACATTGACTATTTCTCGAGAAATAGTCAATGTGTGGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016231
VALIDATED
NLK MISSION shRNA Bacterial Glycerol Stock
nemo-like kinase
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.x-922s1c1
Sequence:CCGGGCTCAGATCATGTCAAAGTTTCTCGAGAAACTTTGACATGATCTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.x-1422s1c1
Sequence:CCGGCTTTGCAGGATGTTGGTCTTTCTCGAGAAAGACCAACATCCTGCAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.x-2413s1c1
Sequence:CCGGGTGGGTAGAGAGAATGAGTTTCTCGAGAAACTCATTCTCTCTACCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016231.x-762s1c1
Sequence:CCGGCGGGAATTGAAGATGTTGTGTCTCGAGACACAACATCTTCAATTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016231.4-1855s21c1
Sequence:GTACCGGTTGCAATTCTGGAGGTTAATCCTCGAGGATTAACCTCCAGAATTGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016231.4-1209s21c1
Sequence:CCGGGAACTACTAGGACGAAGAATACTCGAGTATTCTTCGTCCTAGTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.x-1320s1c1
Sequence:CCGGGAAGGCGCTAAGGCACATATACTCGAGTATATGTGCCTTAGCGCCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.2-1545s1c1
Sequence:CCGGGCAACTGTGTTCTAAAGATTTCTCGAGAAATCTTTAGAACACAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016231.4-1320s21c1
Sequence:CCGGGAAGGCGCTAAGGCACATATACTCGAGTATATGTGCCTTAGCGCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016231.2-3634s1c1
Sequence:CCGGGTGTGTGTTATGGACAATTAACTCGAGTTAATTGTCCATAACACACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016231.4-631s21c1
Sequence:CCGGCGGATAGACCTATTGGATATGCTCGAGCATATCCAATAGGTCTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.2-1143s1c1
Sequence:CCGGCGGATAGACCTATTGGATATGCTCGAGCATATCCAATAGGTCTATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.2-2245s1c1
Sequence:CCGGCTTTATTAGTTCCACTGTTGCCTCGAGGCAACAGTGGAACTAATAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016231.4-1033s21c1
Sequence:CCGGGCAACTGTGTTCTAAAGATTTCTCGAGAAATCTTTAGAACACAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016231
VALIDATED
NLK MISSION shRNA shRNA Plasmid DNA
nemo-like kinase
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.x-922s1c1
Sequence:CCGGGCTCAGATCATGTCAAAGTTTCTCGAGAAACTTTGACATGATCTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.x-1422s1c1
Sequence:CCGGCTTTGCAGGATGTTGGTCTTTCTCGAGAAAGACCAACATCCTGCAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.x-2413s1c1
Sequence:CCGGGTGGGTAGAGAGAATGAGTTTCTCGAGAAACTCATTCTCTCTACCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016231.x-762s1c1
Sequence:CCGGCGGGAATTGAAGATGTTGTGTCTCGAGACACAACATCTTCAATTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016231.4-1855s21c1
Sequence:GTACCGGTTGCAATTCTGGAGGTTAATCCTCGAGGATTAACCTCCAGAATTGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016231.4-1209s21c1
Sequence:CCGGGAACTACTAGGACGAAGAATACTCGAGTATTCTTCGTCCTAGTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.x-1320s1c1
Sequence:CCGGGAAGGCGCTAAGGCACATATACTCGAGTATATGTGCCTTAGCGCCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.2-1545s1c1
Sequence:CCGGGCAACTGTGTTCTAAAGATTTCTCGAGAAATCTTTAGAACACAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016231.4-1320s21c1
Sequence:CCGGGAAGGCGCTAAGGCACATATACTCGAGTATATGTGCCTTAGCGCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016231.2-3634s1c1
Sequence:CCGGGTGTGTGTTATGGACAATTAACTCGAGTTAATTGTCCATAACACACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016231.4-631s21c1
Sequence:CCGGCGGATAGACCTATTGGATATGCTCGAGCATATCCAATAGGTCTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.2-1143s1c1
Sequence:CCGGCGGATAGACCTATTGGATATGCTCGAGCATATCCAATAGGTCTATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.2-2245s1c1
Sequence:CCGGCTTTATTAGTTCCACTGTTGCCTCGAGGCAACAGTGGAACTAATAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016231.4-1033s21c1
Sequence:CCGGGCAACTGTGTTCTAAAGATTTCTCGAGAAATCTTTAGAACACAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016231
VALIDATED
NLK MISSION shRNA Lentiviral Transduction Particles
nemo-like kinase
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.x-922s1c1
Sequence:CCGGGCTCAGATCATGTCAAAGTTTCTCGAGAAACTTTGACATGATCTGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.x-1422s1c1
Sequence:CCGGCTTTGCAGGATGTTGGTCTTTCTCGAGAAAGACCAACATCCTGCAAAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.x-2413s1c1
Sequence:CCGGGTGGGTAGAGAGAATGAGTTTCTCGAGAAACTCATTCTCTCTACCCACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016231.x-762s1c1
Sequence:CCGGCGGGAATTGAAGATGTTGTGTCTCGAGACACAACATCTTCAATTCCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016231.4-1855s21c1
Sequence:GTACCGGTTGCAATTCTGGAGGTTAATCCTCGAGGATTAACCTCCAGAATTGCAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016231.4-1209s21c1
Sequence:CCGGGAACTACTAGGACGAAGAATACTCGAGTATTCTTCGTCCTAGTAGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.x-1320s1c1
Sequence:CCGGGAAGGCGCTAAGGCACATATACTCGAGTATATGTGCCTTAGCGCCTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.2-1545s1c1
Sequence:CCGGGCAACTGTGTTCTAAAGATTTCTCGAGAAATCTTTAGAACACAGTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016231.4-1320s21c1
Sequence:CCGGGAAGGCGCTAAGGCACATATACTCGAGTATATGTGCCTTAGCGCCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016231.2-3634s1c1
Sequence:CCGGGTGTGTGTTATGGACAATTAACTCGAGTTAATTGTCCATAACACACACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016231.4-631s21c1
Sequence:CCGGCGGATAGACCTATTGGATATGCTCGAGCATATCCAATAGGTCTATCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.2-1143s1c1
Sequence:CCGGCGGATAGACCTATTGGATATGCTCGAGCATATCCAATAGGTCTATCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016231.2-2245s1c1
Sequence:CCGGCTTTATTAGTTCCACTGTTGCCTCGAGGCAACAGTGGAACTAATAAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016231.4-1033s21c1
Sequence:CCGGGCAACTGTGTTCTAAAGATTTCTCGAGAAATCTTTAGAACACAGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)