EMAIL THIS PAGE TO A FRIEND

NLN

neurolysin (metallopeptidase M3 family)

114 Gene Product Result for
Synonyms: AGTBP EP24.16 MEP MOP
UniProtKB ID: Q9BYT8, Q9ULJ4
Gene ID:
Human(57486) Summary: This gene encodes a member of the metallopeptidase M3 protein family that cleaves neurotensin at the Pro10-Tyr11 bond, leading to the formation of neurotensin(1-10) and neurotensin(11-13). The encoded protein is likely involved in the termination of the neurotensinergic signal in the central nervous system and in the gastrointestinal tract.[provided by RefSeq, Jun 2010]
Mouse(75805) neurolysin (metallopeptidase M3 family)
Rat(117041) neurolysin (metallopeptidase M3 family)
chicken(427167) neurolysin (metallopeptidase M3 family)
domestic cat(101082801) neurolysin (metallopeptidase M3 family)
cow(538650) neurolysin (metallopeptidase M3 family)
Horse(100057244) neurolysin (metallopeptidase M3 family)
dog(478081) neurolysin (metallopeptidase M3 family)
sheep(101123582) neurolysin (metallopeptidase M3 family)
naked mole-rat(101713060) neurolysin (metallopeptidase M3 family)
domestic guinea pig(100731070) neurolysin (metallopeptidase M3 family)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029447 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029447 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029447 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020726 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020726 siRNAs that have been validated in the lab human pricing
NM_053970 Rosetta Predictions rat pricing
NM_029447 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020726 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213185 validated 2002
1 SASI_Hs01_00213184 validated 897
1 SASI_Hs01_00213183 validated 347
2 SASI_Hs01_00213186 predicted 2079
3 SASI_Hs01_00213188 predicted 851
4 SASI_Hs01_00213189 predicted 2170
5 SASI_Hs02_00353788 predicted 1312
6 SASI_Hs01_00213190 predicted 1850
7 SASI_Hs02_00353789 predicted 1186
8 SASI_Hs01_00213191 predicted 865
9 SASI_Hs01_00213192 predicted 1621
10 SASI_Hs01_00213187 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068849 predicted 1842
2 SASI_Rn02_00266947 predicted 909
3 SASI_Rn01_00068850 predicted 263
4 SASI_Rn01_00068851 predicted 1782
5 SASI_Rn02_00266948 predicted 730
6 SASI_Rn01_00068852 predicted 1919
7 SASI_Rn01_00068853 predicted 1917
8 SASI_Rn01_00068856 predicted 606
9 SASI_Rn01_00068858 predicted 1994
10 SASI_Rn02_00266949 predicted 620
11 SASI_Rn01_00068854 predicted 1058
12 SASI_Rn01_00068855 predicted 1748
13 SASI_Rn01_00068857 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335365 predicted 682
2 SASI_Mm01_00190559 predicted 915
3 SASI_Mm01_00190560 predicted 1113
4 SASI_Mm01_00190561 predicted 2368
5 SASI_Mm01_00190562 predicted 2113
6 SASI_Mm01_00190563 predicted 853
7 SASI_Mm01_00190564 predicted 2042
8 SASI_Mm01_00190565 predicted 1630
9 SASI_Mm01_00190566 predicted 733
10 SASI_Mm01_00190567 predicted 1098
11 SASI_Mm01_00190568 predicted 1362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029447
VALIDATED
NLN MISSION shRNA Bacterial Glycerol Stock
neurolysin (metallopeptidase M3 family)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029447.2-1634s21c1
Sequence:CCGGGCGAACTTACTTCCATGAGTTCTCGAGAACTCATGGAAGTAAGTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029447.2-2050s21c1
Sequence:CCGGGCCAGTATTATGGATATCTTTCTCGAGAAAGATATCCATAATACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029447.2-831s21c1
Sequence:CCGGGACGACTTCATTGACAGTTTACTCGAGTAAACTGTCAATGAAGTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029447.2-1946s21c1
Sequence:CCGGCGCGAGCGAATACGCTAAATACTCGAGTATTTAGCGTATTCGCTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029447.2-1695s21c1
Sequence:CCGGGCACGATTTAGTGGAACAAATCTCGAGATTTGTTCCACTAAATCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029447.1-1919s1c1
Sequence:CCGGCGCGAGCGAATACGCTAAATACTCGAGTATTTAGCGTATTCGCTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029447.1-804s1c1
Sequence:CCGGGACGACTTCATTGACAGTTTACTCGAGTAAACTGTCAATGAAGTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029447.1-1607s1c1
Sequence:CCGGGCGAACTTACTTCCATGAGTTCTCGAGAACTCATGGAAGTAAGTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029447.1-2023s1c1
Sequence:CCGGGCCAGTATTATGGATATCTTTCTCGAGAAAGATATCCATAATACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029447.1-1668s1c1
Sequence:CCGGGCACGATTTAGTGGAACAAATCTCGAGATTTGTTCCACTAAATCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029447
VALIDATED
NLN MISSION shRNA shRNA Plasmid DNA
neurolysin (metallopeptidase M3 family)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029447.2-1634s21c1
Sequence:CCGGGCGAACTTACTTCCATGAGTTCTCGAGAACTCATGGAAGTAAGTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029447.2-2050s21c1
Sequence:CCGGGCCAGTATTATGGATATCTTTCTCGAGAAAGATATCCATAATACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029447.2-831s21c1
Sequence:CCGGGACGACTTCATTGACAGTTTACTCGAGTAAACTGTCAATGAAGTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029447.2-1946s21c1
Sequence:CCGGCGCGAGCGAATACGCTAAATACTCGAGTATTTAGCGTATTCGCTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029447.2-1695s21c1
Sequence:CCGGGCACGATTTAGTGGAACAAATCTCGAGATTTGTTCCACTAAATCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029447.1-1919s1c1
Sequence:CCGGCGCGAGCGAATACGCTAAATACTCGAGTATTTAGCGTATTCGCTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029447.1-804s1c1
Sequence:CCGGGACGACTTCATTGACAGTTTACTCGAGTAAACTGTCAATGAAGTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029447.1-1607s1c1
Sequence:CCGGGCGAACTTACTTCCATGAGTTCTCGAGAACTCATGGAAGTAAGTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029447.1-2023s1c1
Sequence:CCGGGCCAGTATTATGGATATCTTTCTCGAGAAAGATATCCATAATACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029447.1-1668s1c1
Sequence:CCGGGCACGATTTAGTGGAACAAATCTCGAGATTTGTTCCACTAAATCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029447
VALIDATED
NLN MISSION shRNA Lentiviral Transduction Particles
neurolysin (metallopeptidase M3 family)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029447.2-1634s21c1
Sequence:CCGGGCGAACTTACTTCCATGAGTTCTCGAGAACTCATGGAAGTAAGTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029447.2-2050s21c1
Sequence:CCGGGCCAGTATTATGGATATCTTTCTCGAGAAAGATATCCATAATACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029447.2-831s21c1
Sequence:CCGGGACGACTTCATTGACAGTTTACTCGAGTAAACTGTCAATGAAGTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029447.2-1946s21c1
Sequence:CCGGCGCGAGCGAATACGCTAAATACTCGAGTATTTAGCGTATTCGCTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029447.2-1695s21c1
Sequence:CCGGGCACGATTTAGTGGAACAAATCTCGAGATTTGTTCCACTAAATCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029447.1-1919s1c1
Sequence:CCGGCGCGAGCGAATACGCTAAATACTCGAGTATTTAGCGTATTCGCTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029447.1-804s1c1
Sequence:CCGGGACGACTTCATTGACAGTTTACTCGAGTAAACTGTCAATGAAGTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029447.1-1607s1c1
Sequence:CCGGGCGAACTTACTTCCATGAGTTCTCGAGAACTCATGGAAGTAAGTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029447.1-2023s1c1
Sequence:CCGGGCCAGTATTATGGATATCTTTCTCGAGAAAGATATCCATAATACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029447.1-1668s1c1
Sequence:CCGGGCACGATTTAGTGGAACAAATCTCGAGATTTGTTCCACTAAATCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020726
VALIDATED
NLN MISSION shRNA Bacterial Glycerol Stock
neurolysin (metallopeptidase M3 family)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020726.3-393s21c1
Sequence:CCGGGCAGATGTAGAAGTAAAGTATCTCGAGATACTTTACTTCTACATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020726.3-2149s21c1
Sequence:CCGGGCATGGACATGCTCCACAATTCTCGAGAATTGTGGAGCATGTCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020726.3-1997s21c1
Sequence:CCGGGGGATACGATGGCCAATATTACTCGAGTAATATTGGCCATCGTATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_020726.3-2667s21c1
Sequence:CCGGTGGAGCTCTGTGTCAACTTTGCTCGAGCAAAGTTGACACAGAGCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020726.3-1653s21c1
Sequence:CCGGGCACGATTTAGCGGAACAAATCTCGAGATTTGTTCCGCTAAATCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020726.1-1662s1c1
Sequence:CCGGGCACGATTTAGCGGAACAAATCTCGAGATTTGTTCCGCTAAATCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020726.1-2158s1c1
Sequence:CCGGGCATGGACATGCTCCACAATTCTCGAGAATTGTGGAGCATGTCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020726.1-402s1c1
Sequence:CCGGGCAGATGTAGAAGTAAAGTATCTCGAGATACTTTACTTCTACATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020726.1-345s1c1
Sequence:CCGGGCTGTTGGAATGCTCGGTATTCTCGAGAATACCGAGCATTCCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020726.1-1425s1c1
Sequence:CCGGCAGTTCTATTTGGACCTCTATCTCGAGATAGAGGTCCAAATAGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020726
VALIDATED
NLN MISSION shRNA shRNA Plasmid DNA
neurolysin (metallopeptidase M3 family)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020726.3-393s21c1
Sequence:CCGGGCAGATGTAGAAGTAAAGTATCTCGAGATACTTTACTTCTACATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020726.3-2149s21c1
Sequence:CCGGGCATGGACATGCTCCACAATTCTCGAGAATTGTGGAGCATGTCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020726.3-1997s21c1
Sequence:CCGGGGGATACGATGGCCAATATTACTCGAGTAATATTGGCCATCGTATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_020726.3-2667s21c1
Sequence:CCGGTGGAGCTCTGTGTCAACTTTGCTCGAGCAAAGTTGACACAGAGCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020726.3-1653s21c1
Sequence:CCGGGCACGATTTAGCGGAACAAATCTCGAGATTTGTTCCGCTAAATCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020726.1-1662s1c1
Sequence:CCGGGCACGATTTAGCGGAACAAATCTCGAGATTTGTTCCGCTAAATCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020726.1-2158s1c1
Sequence:CCGGGCATGGACATGCTCCACAATTCTCGAGAATTGTGGAGCATGTCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020726.1-402s1c1
Sequence:CCGGGCAGATGTAGAAGTAAAGTATCTCGAGATACTTTACTTCTACATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020726.1-345s1c1
Sequence:CCGGGCTGTTGGAATGCTCGGTATTCTCGAGAATACCGAGCATTCCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020726.1-1425s1c1
Sequence:CCGGCAGTTCTATTTGGACCTCTATCTCGAGATAGAGGTCCAAATAGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020726
VALIDATED
NLN MISSION shRNA Lentiviral Transduction Particles
neurolysin (metallopeptidase M3 family)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020726.3-393s21c1
Sequence:CCGGGCAGATGTAGAAGTAAAGTATCTCGAGATACTTTACTTCTACATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020726.3-2149s21c1
Sequence:CCGGGCATGGACATGCTCCACAATTCTCGAGAATTGTGGAGCATGTCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020726.3-1997s21c1
Sequence:CCGGGGGATACGATGGCCAATATTACTCGAGTAATATTGGCCATCGTATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_020726.3-2667s21c1
Sequence:CCGGTGGAGCTCTGTGTCAACTTTGCTCGAGCAAAGTTGACACAGAGCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020726.3-1653s21c1
Sequence:CCGGGCACGATTTAGCGGAACAAATCTCGAGATTTGTTCCGCTAAATCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020726.1-1662s1c1
Sequence:CCGGGCACGATTTAGCGGAACAAATCTCGAGATTTGTTCCGCTAAATCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020726.1-2158s1c1
Sequence:CCGGGCATGGACATGCTCCACAATTCTCGAGAATTGTGGAGCATGTCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020726.1-402s1c1
Sequence:CCGGGCAGATGTAGAAGTAAAGTATCTCGAGATACTTTACTTCTACATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020726.1-345s1c1
Sequence:CCGGGCTGTTGGAATGCTCGGTATTCTCGAGAATACCGAGCATTCCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020726.1-1425s1c1
Sequence:CCGGCAGTTCTATTTGGACCTCTATCTCGAGATAGAGGTCCAAATAGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)