EMAIL THIS PAGE TO A FRIEND

NLRC4

NLR family, CARD domain containing 4

46 Gene Product Result for
Synonyms: CARD12 CLAN CLAN1 CLANA CLANB CLANC CLAND CLR2.1 IPAF
Gene ID:
Human(58484) Summary: In C. elegans, Ced4 binds and activates Ced3, an apoptotic initiator caspase, via caspase-associated recruitment domains (CARDs). Human Ced4 homologs include APAF1 (MIM 602233), NOD1/CARD4 (MIM 605980), and NOD2/CARD15 (MIM 605956). These proteins have at least 1 N-terminal CARD domain followed by a centrally located nucleotide-binding domain (NBD or NACHT) and a C-terminal regulatory domain, found only in mammals, that contains either WD40 repeats or leucine-rich repeats (LRRs). CARD12 is a member of the Ced4 family and can induce apoptosis.[supplied by OMIM, Mar 2008]
Mouse(268973) NLR family, CARD domain containing 4
Rat(298784) NLR family, CARD domain containing 4
sheep(101104138) NLR family, CARD domain containing 4
naked mole-rat(101712438) NLR family, CARD domain containing 4
domestic guinea pig(100735110) NLR family, CARD domain containing 4
domestic cat(101087657) NLR family, CARD domain containing 4
cow(512480) NLR family, CARD domain containing 4
Horse(100070605) NLR family, CARD domain containing 4
dog(100302328) NLR family, CARD domain containing 4 pseudogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021209 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021209 Rosetta Predictions human pricing
NM_001106707 Rosetta Predictions rat pricing
NM_001033367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184452 predicted 1622
2 SASI_Hs01_00184453 predicted 1986
3 SASI_Hs01_00184454 predicted 550
4 SASI_Hs01_00184456 predicted 2674
5 SASI_Hs02_00354799 predicted 3133
6 SASI_Hs01_00184457 predicted 1335
7 SASI_Hs01_00184458 predicted 2548
8 SASI_Hs01_00184459 predicted 1351
9 SASI_Hs01_00184460 predicted 1902
10 SASI_Hs01_00184461 predicted 1033
11 SASI_Hs01_00184455 predicted 3016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221598 predicted 1026
2 SASI_Rn02_00221599 predicted 882
3 SASI_Rn02_00221600 predicted 225
4 SASI_Rn02_00221601 predicted 962
5 SASI_Rn02_00221602 predicted 379
6 SASI_Rn02_00221603 predicted 517
7 SASI_Rn02_00221604 predicted 690
8 SASI_Rn02_00221605 predicted 455
9 SASI_Rn02_00221606 predicted 921
10 SASI_Rn02_00221607 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106172 predicted 1933
2 SASI_Mm01_00106173 predicted 1020
3 SASI_Mm01_00106174 predicted 1286
4 SASI_Mm02_00288667 predicted 1410
5 SASI_Mm01_00106177 predicted 2214
6 SASI_Mm01_00106178 predicted 1854
7 SASI_Mm01_00106179 predicted 2223
8 SASI_Mm01_00106180 predicted 3254
9 SASI_Mm01_00106181 predicted 2012
10 SASI_Mm02_00288668 predicted 3176
11 SASI_Mm01_00106175 predicted 994
12 SASI_Mm01_00106176 predicted 2407
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033367
NLRC4 MISSION shRNA Bacterial Glycerol Stock
NLR family, CARD domain containing 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000193933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033367.1-247s1c1
Sequence:CCGGCCTTATTCAAAGGATGGGCTTCTCGAGAAGCCCATCCTTTGAATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033367.1-993s1c1
Sequence:CCGGCAGAAATTGAAGCCCTGATAACTCGAGTTATCAGGGCTTCAATTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033367.1-3180s1c1
Sequence:CCGGGTCAAGTGTTATCCAAGTTAACTCGAGTTAACTTGGATAACACTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033367.1-1526s1c2
Sequence:CCGGCCCACGTATAAATTCTTTCATCTCGAGATGAAAGAATTTATACGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033367
NLRC4 MISSION shRNA shRNA Plasmid DNA
NLR family, CARD domain containing 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000193933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033367.1-247s1c1
Sequence:CCGGCCTTATTCAAAGGATGGGCTTCTCGAGAAGCCCATCCTTTGAATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033367.1-993s1c1
Sequence:CCGGCAGAAATTGAAGCCCTGATAACTCGAGTTATCAGGGCTTCAATTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033367.1-3180s1c1
Sequence:CCGGGTCAAGTGTTATCCAAGTTAACTCGAGTTAACTTGGATAACACTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033367.1-1526s1c2
Sequence:CCGGCCCACGTATAAATTCTTTCATCTCGAGATGAAAGAATTTATACGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033367
NLRC4 MISSION shRNA Lentiviral Transduction Particles
NLR family, CARD domain containing 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000193933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033367.1-247s1c1
Sequence:CCGGCCTTATTCAAAGGATGGGCTTCTCGAGAAGCCCATCCTTTGAATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033367.1-993s1c1
Sequence:CCGGCAGAAATTGAAGCCCTGATAACTCGAGTTATCAGGGCTTCAATTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033367.1-3180s1c1
Sequence:CCGGGTCAAGTGTTATCCAAGTTAACTCGAGTTAACTTGGATAACACTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033367.1-1526s1c2
Sequence:CCGGCCCACGTATAAATTCTTTCATCTCGAGATGAAAGAATTTATACGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021209
NLRC4 MISSION shRNA Bacterial Glycerol Stock
NLR family, CARD domain containing 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000160076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-1353s1c1
Sequence:CCGGCCATACCTTCTATGATCTGTTCTCGAGAACAGATCATAGAAGGTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-2263s1c1
Sequence:CCGGCGGGATTTCAGCAAGTTGAATCTCGAGATTCAACTTGCTGAAATCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-939s1c1
Sequence:CCGGCACAATCAGGAAGCAGACATTCTCGAGAATGTCTGCTTCCTGATTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-1040s1c1
Sequence:CCGGCAGAAATCGAAGCCCTGATAACTCGAGTTATCAGGGCTTCGATTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-1561s1c1
Sequence:CCGGCAAAGGTTCAAGCCAAAGTATCTCGAGATACTTTGGCTTGAACCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-2553s1c1
Sequence:CCGGGAACCTTACAAAGCTCATAATCTCGAGATTATGAGCTTTGTAAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-367s1c1
Sequence:CCGGCGCGAAGAAGTAAACATCATTCTCGAGAATGATGTTTACTTCTTCGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-1706s1c1
Sequence:CCGGCGGACATTACATCCACTTATACTCGAGTATAAGTGGATGTAATGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-293s1c1
Sequence:CCGGCCCTTATTCAAAGAATGGGAACTCGAGTTCCCATTCTTTGAATAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021209
NLRC4 MISSION shRNA shRNA Plasmid DNA
NLR family, CARD domain containing 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000160076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-1353s1c1
Sequence:CCGGCCATACCTTCTATGATCTGTTCTCGAGAACAGATCATAGAAGGTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-2263s1c1
Sequence:CCGGCGGGATTTCAGCAAGTTGAATCTCGAGATTCAACTTGCTGAAATCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-939s1c1
Sequence:CCGGCACAATCAGGAAGCAGACATTCTCGAGAATGTCTGCTTCCTGATTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-1040s1c1
Sequence:CCGGCAGAAATCGAAGCCCTGATAACTCGAGTTATCAGGGCTTCGATTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-1561s1c1
Sequence:CCGGCAAAGGTTCAAGCCAAAGTATCTCGAGATACTTTGGCTTGAACCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-2553s1c1
Sequence:CCGGGAACCTTACAAAGCTCATAATCTCGAGATTATGAGCTTTGTAAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-367s1c1
Sequence:CCGGCGCGAAGAAGTAAACATCATTCTCGAGAATGATGTTTACTTCTTCGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-1706s1c1
Sequence:CCGGCGGACATTACATCCACTTATACTCGAGTATAAGTGGATGTAATGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-293s1c1
Sequence:CCGGCCCTTATTCAAAGAATGGGAACTCGAGTTCCCATTCTTTGAATAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021209
NLRC4 MISSION shRNA Lentiviral Transduction Particles
NLR family, CARD domain containing 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000160076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-1353s1c1
Sequence:CCGGCCATACCTTCTATGATCTGTTCTCGAGAACAGATCATAGAAGGTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-2263s1c1
Sequence:CCGGCGGGATTTCAGCAAGTTGAATCTCGAGATTCAACTTGCTGAAATCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-939s1c1
Sequence:CCGGCACAATCAGGAAGCAGACATTCTCGAGAATGTCTGCTTCCTGATTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-1040s1c1
Sequence:CCGGCAGAAATCGAAGCCCTGATAACTCGAGTTATCAGGGCTTCGATTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-1561s1c1
Sequence:CCGGCAAAGGTTCAAGCCAAAGTATCTCGAGATACTTTGGCTTGAACCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-2553s1c1
Sequence:CCGGGAACCTTACAAAGCTCATAATCTCGAGATTATGAGCTTTGTAAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-367s1c1
Sequence:CCGGCGCGAAGAAGTAAACATCATTCTCGAGAATGATGTTTACTTCTTCGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-1706s1c1
Sequence:CCGGCGGACATTACATCCACTTATACTCGAGTATAAGTGGATGTAATGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021209.3-293s1c1
Sequence:CCGGCCCTTATTCAAAGAATGGGAACTCGAGTTCCCATTCTTTGAATAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)