EMAIL THIS PAGE TO A FRIEND

NLRP10

NLR family, pyrin domain containing 10

45 Gene Product Result for
Synonyms: CLR11.1 NALP10 NOD8 PAN5 PYNOD
UniProtKB ID: Q86W26, Q2M3C4, Q6JGT0
Gene ID:
Human(338322) Summary: Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). The protein encoded by this gene belongs to the NALP protein family despite lacking the LRR region. This protein likely plays a regulatory role in the innate immune system. The protein belongs to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. Other experiments indicate that this gene acts as a multifunctional negative regulator of inflammation and apoptosis. [provided by RefSeq, Jul 2008]
Mouse(244202) NLR family, pyrin domain containing 10
Rat(293426) NLR family, pyrin domain containing 10
dog(611323) NLR family, pyrin domain containing 10
Horse(100070865) NLR family, pyrin domain containing 10
domestic cat(101089644) NLR family, pyrin domain containing 10
naked mole-rat(101702326) NLR family, pyrin domain containing 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176821 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175532 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175532 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175532 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176821 Rosetta Predictions human pricing
NM_001106291 Rosetta Predictions rat pricing
NM_175532 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144227 predicted 282
2 SASI_Hs01_00144228 predicted 513
3 SASI_Hs01_00144229 predicted 357
4 SASI_Hs01_00144230 predicted 1042
5 SASI_Hs01_00144231 predicted 1076
6 SASI_Hs01_00144233 predicted 1531
7 SASI_Hs02_00369248 predicted 298
8 SASI_Hs01_00144235 predicted 1631
9 SASI_Hs01_00144236 predicted 1184
10 SASI_Hs02_00369249 predicted 976
11 SASI_Hs01_00144232 predicted 1152
12 SASI_Hs01_00144234 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106291 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217528 predicted 1190
2 SASI_Rn02_00217529 predicted 1834
3 SASI_Rn02_00217530 predicted 2154
4 SASI_Rn02_00217531 predicted 1689
5 SASI_Rn02_00217532 predicted 1859
6 SASI_Rn02_00217533 predicted 322
7 SASI_Rn02_00217534 predicted 996
8 SASI_Rn02_00217535 predicted 1988
9 SASI_Rn02_00217536 predicted 1065
10 SASI_Rn02_00217537 predicted 2076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175532 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025709 predicted 1824
2 SASI_Mm01_00025710 predicted 1500
3 SASI_Mm01_00025711 predicted 1001
4 SASI_Mm01_00025712 predicted 396
5 SASI_Mm01_00025713 predicted 1538
6 SASI_Mm01_00025714 predicted 1044
7 SASI_Mm02_00346477 predicted 779
8 SASI_Mm01_00025715 predicted 1764
9 SASI_Mm01_00025716 predicted 579
10 SASI_Mm01_00025717 predicted 448
11 SASI_Mm01_00025708 predicted 1153
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176821
NLRP10 MISSION shRNA Bacterial Glycerol Stock
NLR family, pyrin domain containing 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176821.2-1045s1c1
Sequence:CCGGCTCTACAAAGCGTGTCAGGTTCTCGAGAACCTGACACGCTTTGTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176821.2-539s1c1
Sequence:CCGGGAAAGACAACTCTCGCCAGAACTCGAGTTCTGGCGAGAGTTGTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176821.2-968s1c1
Sequence:CCGGCGAGGTACTTCAGCTCCTATTCTCGAGAATAGGAGCTGAAGTACCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176821.2-63s1c1
Sequence:CCGGCCTTGAGGAGAACGATTTCAACTCGAGTTGAAATCGTTCTCCTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176821.2-1659s1c1
Sequence:CCGGGATGGAATCTATGAAGCACAACTCGAGTTGTGCTTCATAGATTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176821
NLRP10 MISSION shRNA shRNA Plasmid DNA
NLR family, pyrin domain containing 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176821.2-1045s1c1
Sequence:CCGGCTCTACAAAGCGTGTCAGGTTCTCGAGAACCTGACACGCTTTGTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176821.2-539s1c1
Sequence:CCGGGAAAGACAACTCTCGCCAGAACTCGAGTTCTGGCGAGAGTTGTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176821.2-968s1c1
Sequence:CCGGCGAGGTACTTCAGCTCCTATTCTCGAGAATAGGAGCTGAAGTACCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176821.2-63s1c1
Sequence:CCGGCCTTGAGGAGAACGATTTCAACTCGAGTTGAAATCGTTCTCCTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176821.2-1659s1c1
Sequence:CCGGGATGGAATCTATGAAGCACAACTCGAGTTGTGCTTCATAGATTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176821
NLRP10 MISSION shRNA Lentiviral Transduction Particles
NLR family, pyrin domain containing 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176821.2-1045s1c1
Sequence:CCGGCTCTACAAAGCGTGTCAGGTTCTCGAGAACCTGACACGCTTTGTAGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176821.2-539s1c1
Sequence:CCGGGAAAGACAACTCTCGCCAGAACTCGAGTTCTGGCGAGAGTTGTCTTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176821.2-968s1c1
Sequence:CCGGCGAGGTACTTCAGCTCCTATTCTCGAGAATAGGAGCTGAAGTACCTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176821.2-63s1c1
Sequence:CCGGCCTTGAGGAGAACGATTTCAACTCGAGTTGAAATCGTTCTCCTCAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176821.2-1659s1c1
Sequence:CCGGGATGGAATCTATGAAGCACAACTCGAGTTGTGCTTCATAGATTCCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175532
NLRP10 MISSION shRNA Bacterial Glycerol Stock
NLR family, pyrin domain containing 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175532.2-2205s1c1
Sequence:CCGGCCACAGATATTGGAAGTTTAACTCGAGTTAAACTTCCAATATCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175532.2-1836s1c1
Sequence:CCGGCGGGAAGGTACAAAGTCCATTCTCGAGAATGGACTTTGTACCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175532.2-329s1c1
Sequence:CCGGGTCTGAATGATTACAGAGAAACTCGAGTTTCTCTGTAATCATTCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175532.2-321s1c1
Sequence:CCGGCCAGGTTTGTCTGAATGATTACTCGAGTAATCATTCAGACAAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175532.2-1380s1c1
Sequence:CCGGGCTTGGCATCAAGAAATTCTACTCGAGTAGAATTTCTTGATGCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175532
NLRP10 MISSION shRNA shRNA Plasmid DNA
NLR family, pyrin domain containing 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175532.2-2205s1c1
Sequence:CCGGCCACAGATATTGGAAGTTTAACTCGAGTTAAACTTCCAATATCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175532.2-1836s1c1
Sequence:CCGGCGGGAAGGTACAAAGTCCATTCTCGAGAATGGACTTTGTACCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175532.2-329s1c1
Sequence:CCGGGTCTGAATGATTACAGAGAAACTCGAGTTTCTCTGTAATCATTCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175532.2-321s1c1
Sequence:CCGGCCAGGTTTGTCTGAATGATTACTCGAGTAATCATTCAGACAAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175532.2-1380s1c1
Sequence:CCGGGCTTGGCATCAAGAAATTCTACTCGAGTAGAATTTCTTGATGCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175532
NLRP10 MISSION shRNA Lentiviral Transduction Particles
NLR family, pyrin domain containing 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175532.2-2205s1c1
Sequence:CCGGCCACAGATATTGGAAGTTTAACTCGAGTTAAACTTCCAATATCTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175532.2-1836s1c1
Sequence:CCGGCGGGAAGGTACAAAGTCCATTCTCGAGAATGGACTTTGTACCTTCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175532.2-329s1c1
Sequence:CCGGGTCTGAATGATTACAGAGAAACTCGAGTTTCTCTGTAATCATTCAGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175532.2-321s1c1
Sequence:CCGGCCAGGTTTGTCTGAATGATTACTCGAGTAATCATTCAGACAAACCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175532.2-1380s1c1
Sequence:CCGGGCTTGGCATCAAGAAATTCTACTCGAGTAGAATTTCTTGATGCCAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)