EMAIL THIS PAGE TO A FRIEND

NLRP13

NLR family, pyrin domain containing 13

23 Gene Product Result for
Synonyms: CLR19.7 NALP13 NOD14 PAN13
UniProtKB ID: Q86W25, Q7RTR5
Gene ID:
Human(126204) Summary: NALPs are cytoplasmic proteins that form a subfamily within the larger CATERPILLER protein family. Most short NALPs, such as NALP13, have an N-terminal pyrin (MEFV; MIM 608107) domain (PYD), followed by a NACHT domain, a NACHT-associated domain (NAD), and a C-terminal leucine-rich repeat (LRR) region. The long NALP, NALP1 (MIM 606636), also has a C-terminal extension containing a function to find domain (FIIND) and a caspase recruitment domain (CARD). NALPs are implicated in the activation of proinflammatory caspases (e.g., CASP1; MIM 147678) via their involvement in multiprotein complexes called inflammasomes (Tschopp et al., 2003 [PubMed 12563287]
sheep(101109118) NLR family, pyrin domain containing 13
dog(484287) NLR family, pyrin domain containing 13
domestic cat(101087026) NLR family, pyrin domain containing 13
cow(529844) NLR family, pyrin domain containing 13
Horse(100057404) NLR family, pyrin domain containing 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176810 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176810 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369221 predicted 2544
2 SASI_Hs01_00063274 predicted 1094
3 SASI_Hs01_00063276 predicted 860
4 SASI_Hs01_00063277 predicted 2179
5 SASI_Hs01_00063278 predicted 1135
6 SASI_Hs02_00369222 predicted 313
7 SASI_Hs01_00063280 predicted 1986
8 SASI_Hs02_00369223 predicted 1497
9 SASI_Hs01_00063282 predicted 1369
10 SASI_Hs02_00369224 predicted 2668
11 SASI_Hs01_00063273 predicted 1473
12 SASI_Hs01_00063275 predicted 594
13 SASI_Hs01_00063279 predicted 2782
14 SASI_Hs01_00063281 predicted 541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176810
NLRP13 MISSION shRNA Bacterial Glycerol Stock
NLR family, pyrin domain containing 13
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-1828s1c1
Sequence:CCGGCCCAGGGTAATGGAGGAATTACTCGAGTAATTCCTCCATTACCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-2269s1c1
Sequence:CCGGGTCCAGAAACTGACGTGCAAACTCGAGTTTGCACGTCAGTTTCTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-193s1c1
Sequence:CCGGCCTTTGAATCTGTCCTTTCTTCTCGAGAAGAAAGGACAGATTCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-1969s1c1
Sequence:CCGGCGTATCTTTGAAGTTGACCTTCTCGAGAAGGTCAACTTCAAAGATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-907s1c1
Sequence:CCGGCCAGAGAAGCTCCTGTTTATTCTCGAGAATAAACAGGAGCTTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-1104s1c1
Sequence:CCGGGAGAGATCTTAAGGCCTCATTCTCGAGAATGAGGCCTTAAGATCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-1829s1c1
Sequence:CCGGCCAGGGTAATGGAGGAATTATCTCGAGATAATTCCTCCATTACCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-2354s1c1
Sequence:CCGGCCCATCTGAACTTCAGCTCTACTCGAGTAGAGCTGAAGTTCAGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-587s1c1
Sequence:CCGGGTTGGCCTAAAGACCACGTATCTCGAGATACGTGGTCTTTAGGCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176810
NLRP13 MISSION shRNA shRNA Plasmid DNA
NLR family, pyrin domain containing 13
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-1828s1c1
Sequence:CCGGCCCAGGGTAATGGAGGAATTACTCGAGTAATTCCTCCATTACCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-2269s1c1
Sequence:CCGGGTCCAGAAACTGACGTGCAAACTCGAGTTTGCACGTCAGTTTCTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-193s1c1
Sequence:CCGGCCTTTGAATCTGTCCTTTCTTCTCGAGAAGAAAGGACAGATTCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-1969s1c1
Sequence:CCGGCGTATCTTTGAAGTTGACCTTCTCGAGAAGGTCAACTTCAAAGATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-907s1c1
Sequence:CCGGCCAGAGAAGCTCCTGTTTATTCTCGAGAATAAACAGGAGCTTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-1104s1c1
Sequence:CCGGGAGAGATCTTAAGGCCTCATTCTCGAGAATGAGGCCTTAAGATCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-1829s1c1
Sequence:CCGGCCAGGGTAATGGAGGAATTATCTCGAGATAATTCCTCCATTACCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-2354s1c1
Sequence:CCGGCCCATCTGAACTTCAGCTCTACTCGAGTAGAGCTGAAGTTCAGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-587s1c1
Sequence:CCGGGTTGGCCTAAAGACCACGTATCTCGAGATACGTGGTCTTTAGGCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176810
NLRP13 MISSION shRNA Lentiviral Transduction Particles
NLR family, pyrin domain containing 13
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-1828s1c1
Sequence:CCGGCCCAGGGTAATGGAGGAATTACTCGAGTAATTCCTCCATTACCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-2269s1c1
Sequence:CCGGGTCCAGAAACTGACGTGCAAACTCGAGTTTGCACGTCAGTTTCTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-193s1c1
Sequence:CCGGCCTTTGAATCTGTCCTTTCTTCTCGAGAAGAAAGGACAGATTCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-1969s1c1
Sequence:CCGGCGTATCTTTGAAGTTGACCTTCTCGAGAAGGTCAACTTCAAAGATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-907s1c1
Sequence:CCGGCCAGAGAAGCTCCTGTTTATTCTCGAGAATAAACAGGAGCTTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-1104s1c1
Sequence:CCGGGAGAGATCTTAAGGCCTCATTCTCGAGAATGAGGCCTTAAGATCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-1829s1c1
Sequence:CCGGCCAGGGTAATGGAGGAATTATCTCGAGATAATTCCTCCATTACCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-2354s1c1
Sequence:CCGGCCCATCTGAACTTCAGCTCTACTCGAGTAGAGCTGAAGTTCAGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176810.1-587s1c1
Sequence:CCGGGTTGGCCTAAAGACCACGTATCTCGAGATACGTGGTCTTTAGGCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)