EMAIL THIS PAGE TO A FRIEND

NLRP4

NLR family, pyrin domain containing 4

41 Gene Product Result for
Synonyms: CLR19.5 CT58 NALP4 PAN2 PYPAF4 RNH2
UniProtKB ID: Q96MN2, Q86W87, Q96AY6
Gene ID:
Human(147945) Summary: NALPs are cytoplasmic proteins that form a subfamily within the larger CATERPILLER protein family. Most short NALPs, such as NALP4, have an N-terminal pyrin (MEFV; MIM 608107) domain (PYD), followed by a NACHT domain, a NACHT-associated domain (NAD), and a C-terminal leucine-rich repeat (LRR) region. The long NALP, NALP1 (MIM 606636), also has a C-terminal extension containing a function to find domain (FIIND) and a caspase recruitment domain (CARD). NALPs are implicated in the activation of proinflammatory caspases (e.g., CASP1; MIM 147678) via their involvement in multiprotein complexes called inflammasomes (Tschopp et al., 2003 [PubMed 12563287]
Rat(499069) NLR family, pyrin domain containing 4
Horse(100050883) NLR family, pyrin domain containing 4
domestic cat(101087284) NLR family, pyrin domain containing 4
naked mole-rat(101719127) NLR family, pyrin domain containing 4
Domestic Rabbit(100349971) NLR family, pyrin domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_134444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_134444 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141341 MISSION® esiRNA esiRNA human NLRP4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_134444 Rosetta Predictions human pricing
XM_001060698 Rosetta Predictions rat pricing
XM_574350 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363329 predicted 2752
2 SASI_Hs01_00049003 predicted 2455
3 SASI_Hs01_00049004 predicted 1694
4 SASI_Hs01_00049005 predicted 2782
5 SASI_Hs01_00049006 predicted 1022
6 SASI_Hs01_00049007 predicted 2664
7 SASI_Hs01_00049008 predicted 255
8 SASI_Hs01_00049009 predicted 341
9 SASI_Hs01_00049010 predicted 217
10 SASI_Hs01_00049011 predicted 2736
11 SASI_Hs01_00049012 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297402 predicted 3284
2 SASI_Rn02_00297403 predicted 675
3 SASI_Rn02_00297404 predicted 2379
4 SASI_Rn02_00297405 predicted 1500
5 SASI_Rn02_00297406 predicted 1468
6 SASI_Rn02_00297407 predicted 804
7 SASI_Rn02_00297408 predicted 616
8 SASI_Rn02_00297409 predicted 702
9 SASI_Rn02_00297410 predicted 3386
10 SASI_Rn02_00297411 predicted 2243
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401811 predicted 3281
2 SASI_Rn02_00401812 predicted 677
3 SASI_Rn02_00401813 predicted 2378
4 SASI_Rn02_00401814 predicted 1496
5 SASI_Rn02_00401815 predicted 1463
6 SASI_Rn02_00401816 predicted 804
7 SASI_Rn02_00401817 predicted 619
8 SASI_Rn02_00401818 predicted 700
9 SASI_Rn02_00401819 predicted 3391
10 SASI_Rn02_00401820 predicted 2235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134444
NLRP4 MISSION shRNA Bacterial Glycerol Stock
NLR family, pyrin domain containing 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134444.4-2064s21c1
Sequence:CCGGGTGGATTCCTTGGCGATATTTCTCGAGAAATATCGCCAAGGAATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134444.4-937s21c1
Sequence:CCGGGGTCGGACAACAAGATCTTTCCTCGAGGAAAGATCTTGTTGTCCGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134444.4-1534s21c1
Sequence:CCGGTGTACTCCTCTTTCGTCTTTACTCGAGTAAAGACGAAAGAGGAGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134444.4-965s21c1
Sequence:CCGGGTTCCTGTACACGTTCTATTTCTCGAGAAATAGAACGTGTACAGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134444.1-1104s1c1
Sequence:CCGGGATCCTGTGTACCAGTCTGAACTCGAGTTCAGACTGGTACACAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134444.1-2255s1c1
Sequence:CCGGCGCTGGTAAATTGTCACCTCTCTCGAGAGAGGTGACAATTTACCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134444.1-2994s1c1
Sequence:CCGGGAGAAATCCTAACCTGACCATCTCGAGATGGTCAGGTTAGGATTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134444.1-163s1c1
Sequence:CCGGCAAATGACTTTGCAGCTTGAACTCGAGTTCAAGCTGCAAAGTCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134444.1-1640s1c1
Sequence:CCGGCCCAAGAGATAAAGCAGCAAACTCGAGTTTGCTGCTTTATCTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134444.1-2670s1c1
Sequence:CCGGGATTCTGCAAATTGGGTGCAACTCGAGTTGCACCCAATTTGCAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134444.1-978s1c1
Sequence:CCGGCGAGAGTGATAGGTTAGTGTACTCGAGTACACTAACCTATCACTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134444.1-2278s1c1
Sequence:CCGGCCCATTGATTGTGAAGTCCTTCTCGAGAAGGACTTCACAATCAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134444
NLRP4 MISSION shRNA shRNA Plasmid DNA
NLR family, pyrin domain containing 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134444.4-2064s21c1
Sequence:CCGGGTGGATTCCTTGGCGATATTTCTCGAGAAATATCGCCAAGGAATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134444.4-937s21c1
Sequence:CCGGGGTCGGACAACAAGATCTTTCCTCGAGGAAAGATCTTGTTGTCCGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134444.4-1534s21c1
Sequence:CCGGTGTACTCCTCTTTCGTCTTTACTCGAGTAAAGACGAAAGAGGAGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134444.4-965s21c1
Sequence:CCGGGTTCCTGTACACGTTCTATTTCTCGAGAAATAGAACGTGTACAGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134444.1-1104s1c1
Sequence:CCGGGATCCTGTGTACCAGTCTGAACTCGAGTTCAGACTGGTACACAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134444.1-2255s1c1
Sequence:CCGGCGCTGGTAAATTGTCACCTCTCTCGAGAGAGGTGACAATTTACCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134444.1-2994s1c1
Sequence:CCGGGAGAAATCCTAACCTGACCATCTCGAGATGGTCAGGTTAGGATTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134444.1-163s1c1
Sequence:CCGGCAAATGACTTTGCAGCTTGAACTCGAGTTCAAGCTGCAAAGTCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134444.1-1640s1c1
Sequence:CCGGCCCAAGAGATAAAGCAGCAAACTCGAGTTTGCTGCTTTATCTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134444.1-2670s1c1
Sequence:CCGGGATTCTGCAAATTGGGTGCAACTCGAGTTGCACCCAATTTGCAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134444.1-978s1c1
Sequence:CCGGCGAGAGTGATAGGTTAGTGTACTCGAGTACACTAACCTATCACTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134444.1-2278s1c1
Sequence:CCGGCCCATTGATTGTGAAGTCCTTCTCGAGAAGGACTTCACAATCAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134444
NLRP4 MISSION shRNA Lentiviral Transduction Particles
NLR family, pyrin domain containing 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134444.4-2064s21c1
Sequence:CCGGGTGGATTCCTTGGCGATATTTCTCGAGAAATATCGCCAAGGAATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134444.4-937s21c1
Sequence:CCGGGGTCGGACAACAAGATCTTTCCTCGAGGAAAGATCTTGTTGTCCGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134444.4-1534s21c1
Sequence:CCGGTGTACTCCTCTTTCGTCTTTACTCGAGTAAAGACGAAAGAGGAGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134444.4-965s21c1
Sequence:CCGGGTTCCTGTACACGTTCTATTTCTCGAGAAATAGAACGTGTACAGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134444.1-1104s1c1
Sequence:CCGGGATCCTGTGTACCAGTCTGAACTCGAGTTCAGACTGGTACACAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134444.1-2255s1c1
Sequence:CCGGCGCTGGTAAATTGTCACCTCTCTCGAGAGAGGTGACAATTTACCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134444.1-2994s1c1
Sequence:CCGGGAGAAATCCTAACCTGACCATCTCGAGATGGTCAGGTTAGGATTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134444.1-163s1c1
Sequence:CCGGCAAATGACTTTGCAGCTTGAACTCGAGTTCAAGCTGCAAAGTCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134444.1-1640s1c1
Sequence:CCGGCCCAAGAGATAAAGCAGCAAACTCGAGTTTGCTGCTTTATCTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134444.1-2670s1c1
Sequence:CCGGGATTCTGCAAATTGGGTGCAACTCGAGTTGCACCCAATTTGCAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134444.1-978s1c1
Sequence:CCGGCGAGAGTGATAGGTTAGTGTACTCGAGTACACTAACCTATCACTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134444.1-2278s1c1
Sequence:CCGGCCCATTGATTGTGAAGTCCTTCTCGAGAAGGACTTCACAATCAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)