EMAIL THIS PAGE TO A FRIEND

NLRP5

NLR family, pyrin domain containing 5

68 Gene Product Result for
Synonyms: CLR19.8 MATER NALP5 PAN11 PYPAF8
UniProtKB ID: P59047, A8MTY4, Q86W29
Gene ID:
Human(126206) Summary: The protein encoded by this gene belongs to the NALP protein family. Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). Expression of this gene is restricted to the oocyte. A mouse gene that encodes a maternal oocyte protein, similar to this encoded protein, is required for normal early embryogenesis. [provided by RefSeq, Jul 2008]
Mouse(23968) NLR family, pyrin domain containing 5
Rat(308325) NLR family, pyrin domain containing 5
sheep(101109385) NLR family, pyrin domain containing 5
sheep(100272223) NLR family, pyrin domain containing 5
cow(493717) NLR family, pyrin domain containing 5
Horse(100057440) NLR family, pyrin domain containing 5
domestic cat(101081176) NLR family, pyrin domain containing 5
dog(476373) NLR family, pyrin domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011860 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011860 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011860 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153447 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002041 MISSION® esiRNA esiRNA targeting human NALP5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153447 Rosetta Predictions human pricing
NM_001107474 Rosetta Predictions rat pricing
NM_001039143 Rosetta Predictions mouse pricing
NM_011860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158784 predicted 2431
2 SASI_Hs01_00158785 predicted 3094
3 SASI_Hs01_00158786 predicted 2071
4 SASI_Hs01_00158787 predicted 557
5 SASI_Hs01_00158788 predicted 2265
6 SASI_Hs01_00158789 predicted 911
7 SASI_Hs01_00158790 predicted 1559
8 SASI_Hs01_00158791 predicted 870
9 SASI_Hs01_00158792 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107474 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229185 predicted 814
2 SASI_Rn02_00229186 predicted 1909
3 SASI_Rn02_00229187 predicted 2329
4 SASI_Rn02_00229188 predicted 2367
5 SASI_Rn02_00229189 predicted 1686
6 SASI_Rn02_00229190 predicted 1074
7 SASI_Rn02_00229191 predicted 2139
8 SASI_Rn02_00229192 predicted 1618
9 SASI_Rn02_00229193 predicted 2480
10 SASI_Rn02_00229194 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103562 predicted 1310
2 SASI_Mm01_00103563 predicted 2372
3 SASI_Mm01_00103565 predicted 1316
4 SASI_Mm01_00103567 predicted 215
5 SASI_Mm01_00103568 predicted 1423
6 SASI_Mm01_00103569 predicted 734
7 SASI_Mm01_00103570 predicted 1075
8 SASI_Mm01_00103571 predicted 1081
9 SASI_Mm02_00289846 predicted 3231
10 SASI_Mm02_00289847 predicted 1402
11 SASI_Mm01_00103564 predicted 805
12 SASI_Mm01_00103566 predicted 1935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105742 predicted 1365
2 SASI_Mm01_00105743 predicted 2425
3 SASI_Mm01_00105745 predicted 1371
4 SASI_Mm01_00105747 predicted 211
5 SASI_Mm01_00105748 predicted 1470
6 SASI_Mm01_00105749 predicted 777
7 SASI_Mm01_00105750 predicted 1118
8 SASI_Mm01_00105751 predicted 1134
9 SASI_Mm02_00321618 predicted 3274
10 SASI_Mm02_00321619 predicted 1448
11 SASI_Mm01_00105744 predicted 860
12 SASI_Mm01_00105746 predicted 1985
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011860
NLRP5 MISSION shRNA Bacterial Glycerol Stock
NLR family, pyrin domain containing 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011860.1-896s1c1
Sequence:CCGGGCCCATATACATCCTGATGTACTCGAGTACATCAGGATGTATATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011860.1-1640s1c1
Sequence:CCGGGCGTTTCTTATTTGGCCTCATCTCGAGATGAGGCCAAATAAGAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011860.1-3048s1c1
Sequence:CCGGGCATGTAAGTTGACTTCCAATCTCGAGATTGGAAGTCAACTTACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011860.1-576s1c1
Sequence:CCGGCCTCACACCATTATCCTACATCTCGAGATGTAGGATAATGGTGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011860.1-1629s1c1
Sequence:CCGGCTCGGGATGAAGCGTTTCTTACTCGAGTAAGAAACGCTTCATCCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011860
NLRP5 MISSION shRNA shRNA Plasmid DNA
NLR family, pyrin domain containing 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011860.1-896s1c1
Sequence:CCGGGCCCATATACATCCTGATGTACTCGAGTACATCAGGATGTATATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011860.1-1640s1c1
Sequence:CCGGGCGTTTCTTATTTGGCCTCATCTCGAGATGAGGCCAAATAAGAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011860.1-3048s1c1
Sequence:CCGGGCATGTAAGTTGACTTCCAATCTCGAGATTGGAAGTCAACTTACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011860.1-576s1c1
Sequence:CCGGCCTCACACCATTATCCTACATCTCGAGATGTAGGATAATGGTGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011860.1-1629s1c1
Sequence:CCGGCTCGGGATGAAGCGTTTCTTACTCGAGTAAGAAACGCTTCATCCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011860
NLRP5 MISSION shRNA Lentiviral Transduction Particles
NLR family, pyrin domain containing 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011860.1-896s1c1
Sequence:CCGGGCCCATATACATCCTGATGTACTCGAGTACATCAGGATGTATATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011860.1-1640s1c1
Sequence:CCGGGCGTTTCTTATTTGGCCTCATCTCGAGATGAGGCCAAATAAGAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011860.1-3048s1c1
Sequence:CCGGGCATGTAAGTTGACTTCCAATCTCGAGATTGGAAGTCAACTTACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011860.1-576s1c1
Sequence:CCGGCCTCACACCATTATCCTACATCTCGAGATGTAGGATAATGGTGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011860.1-1629s1c1
Sequence:CCGGCTCGGGATGAAGCGTTTCTTACTCGAGTAAGAAACGCTTCATCCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153447
NLRP5 MISSION shRNA Bacterial Glycerol Stock
NLR family, pyrin domain containing 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153447.2-3630s1c1
Sequence:CCGGCCCATCTGATGGAGGAACTTTCTCGAGAAAGTTCCTCCATCAGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-2508s1c1
Sequence:CCGGCCGTAACCTAAGATCCCTCAACTCGAGTTGAGGGATCTTAGGTTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153447.2-3718s1c1
Sequence:CCGGGATTCTCACAAAGCCCTCAATCTCGAGATTGAGGGCTTTGTGAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-1874s1c1
Sequence:CCGGGCTTCCATATCCACTCGCTTTCTCGAGAAAGCGAGTGGATATGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-1553s1c1
Sequence:CCGGGCTGTCTCAATCTGGAGGAAACTCGAGTTTCCTCCAGATTGAGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-3390s1c1
Sequence:CCGGGCAGAATAACTTCAGTCCCAACTCGAGTTGGGACTGAAGTTATTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-3391s1c1
Sequence:CCGGCAGAATAACTTCAGTCCCAAACTCGAGTTTGGGACTGAAGTTATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-857s1c1
Sequence:CCGGGAAAGTCAGGAATTGGGAAATCTCGAGATTTCCCAATTCCTGACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-3446s1c1
Sequence:CCGGCCACGTCTAACTTACAGATAACTCGAGTTATCTGTAAGTTAGACGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153447.2-3631s1c1
Sequence:CCGGCCATCTGATGGAGGAACTTTACTCGAGTAAAGTTCCTCCATCAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-370s1c1
Sequence:CCGGGCTACGTCCATTAGCATCTTTCTCGAGAAAGATGCTAATGGACGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153447
NLRP5 MISSION shRNA shRNA Plasmid DNA
NLR family, pyrin domain containing 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153447.2-3630s1c1
Sequence:CCGGCCCATCTGATGGAGGAACTTTCTCGAGAAAGTTCCTCCATCAGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-2508s1c1
Sequence:CCGGCCGTAACCTAAGATCCCTCAACTCGAGTTGAGGGATCTTAGGTTACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153447.2-3718s1c1
Sequence:CCGGGATTCTCACAAAGCCCTCAATCTCGAGATTGAGGGCTTTGTGAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-1874s1c1
Sequence:CCGGGCTTCCATATCCACTCGCTTTCTCGAGAAAGCGAGTGGATATGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-1553s1c1
Sequence:CCGGGCTGTCTCAATCTGGAGGAAACTCGAGTTTCCTCCAGATTGAGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-3390s1c1
Sequence:CCGGGCAGAATAACTTCAGTCCCAACTCGAGTTGGGACTGAAGTTATTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-3391s1c1
Sequence:CCGGCAGAATAACTTCAGTCCCAAACTCGAGTTTGGGACTGAAGTTATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-857s1c1
Sequence:CCGGGAAAGTCAGGAATTGGGAAATCTCGAGATTTCCCAATTCCTGACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-3446s1c1
Sequence:CCGGCCACGTCTAACTTACAGATAACTCGAGTTATCTGTAAGTTAGACGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153447.2-3631s1c1
Sequence:CCGGCCATCTGATGGAGGAACTTTACTCGAGTAAAGTTCCTCCATCAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-370s1c1
Sequence:CCGGGCTACGTCCATTAGCATCTTTCTCGAGAAAGATGCTAATGGACGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153447
NLRP5 MISSION shRNA Lentiviral Transduction Particles
NLR family, pyrin domain containing 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153447.2-3630s1c1
Sequence:CCGGCCCATCTGATGGAGGAACTTTCTCGAGAAAGTTCCTCCATCAGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-2508s1c1
Sequence:CCGGCCGTAACCTAAGATCCCTCAACTCGAGTTGAGGGATCTTAGGTTACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153447.2-3718s1c1
Sequence:CCGGGATTCTCACAAAGCCCTCAATCTCGAGATTGAGGGCTTTGTGAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-1874s1c1
Sequence:CCGGGCTTCCATATCCACTCGCTTTCTCGAGAAAGCGAGTGGATATGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-1553s1c1
Sequence:CCGGGCTGTCTCAATCTGGAGGAAACTCGAGTTTCCTCCAGATTGAGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-3390s1c1
Sequence:CCGGGCAGAATAACTTCAGTCCCAACTCGAGTTGGGACTGAAGTTATTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-3391s1c1
Sequence:CCGGCAGAATAACTTCAGTCCCAAACTCGAGTTTGGGACTGAAGTTATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-857s1c1
Sequence:CCGGGAAAGTCAGGAATTGGGAAATCTCGAGATTTCCCAATTCCTGACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-3446s1c1
Sequence:CCGGCCACGTCTAACTTACAGATAACTCGAGTTATCTGTAAGTTAGACGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153447.2-3631s1c1
Sequence:CCGGCCATCTGATGGAGGAACTTTACTCGAGTAAAGTTCCTCCATCAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153447.2-370s1c1
Sequence:CCGGGCTACGTCCATTAGCATCTTTCTCGAGAAAGATGCTAATGGACGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)