EMAIL THIS PAGE TO A FRIEND

NLRP7

NLR family, pyrin domain containing 7

65 Gene Product Result for
Synonyms: CLR19.4 HYDM NALP7 NOD12 PAN7 PYPAF3
UniProtKB ID: Q8WX94, E9PE16, Q32MH8, Q7RTR1
Gene ID:
Human(199713) Summary: This gene encodes a member of the NACHT, leucine rich repeat, and PYD containing (NLRP) protein family. It has an N-terminal pyrin domain, followed by a NACHT domain, a NACHT-associated domain (NAD), and a C-terminal leucine-rich repeat (LRR) region. NLRP proteins are implicated in the activation of proinflammatory caspases through multiprotein complexes called inflammasomes. This gene may act as a feedback regulator of caspase-1-dependent interleukin 1-beta secretion. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
cow(100336623) NLR family, pyrin domain containing 7
domestic cat(101094063) NLR family, pyrin domain containing 7
cow(100301263) NLR family, pyrin domain containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139176 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127255 Rosetta Predictions human pricing
NM_139176 Rosetta Predictions human pricing
NM_206828 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329047 predicted 2594
2 SASI_Hs02_00329048 predicted 2600
3 SASI_Hs02_00329049 predicted 281
4 SASI_Hs02_00329050 predicted 525
5 SASI_Hs02_00329051 predicted 410
6 SASI_Hs02_00329052 predicted 1614
7 SASI_Hs02_00329053 predicted 2407
8 SASI_Hs02_00329054 predicted 636
9 SASI_Hs02_00329055 predicted 1757
10 SASI_Hs02_00329056 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136580 predicted 2510
2 SASI_Hs01_00136584 predicted 2516
3 SASI_Hs01_00136586 predicted 286
4 SASI_Hs01_00136587 predicted 522
5 SASI_Hs01_00136588 predicted 410
6 SASI_Hs01_00136589 predicted 1615
7 SASI_Hs02_00364212 predicted 2326
8 SASI_Hs02_00364213 predicted 643
9 SASI_Hs02_00364214 predicted 1759
10 SASI_Hs02_00364215 predicted 295
11 SASI_Hs01_00136581 predicted 532
12 SASI_Hs01_00136582 predicted 1719
13 SASI_Hs01_00136583 predicted 1731
14 SASI_Hs01_00136585 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168458 predicted 2586
2 SASI_Hs01_00168462 predicted 2609
3 SASI_Hs01_00168464 predicted 289
4 SASI_Hs01_00168465 predicted 524
5 SASI_Hs01_00168466 predicted 412
6 SASI_Hs01_00168467 predicted 1615
7 SASI_Hs02_00373552 predicted 2404
8 SASI_Hs02_00373553 predicted 642
9 SASI_Hs02_00373554 predicted 1755
10 SASI_Hs02_00373555 predicted 297
11 SASI_Hs01_00168459 predicted 538
12 SASI_Hs01_00168460 predicted 1712
13 SASI_Hs01_00168461 predicted 1738
14 SASI_Hs01_00168463 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139176
NLRP7 MISSION shRNA Bacterial Glycerol Stock
NLR family, pyrin domain containing 7
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000128829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139176.2-1723s1c1
Sequence:CCGGGCAATGCAAAGCACATCTTCACTCGAGTGAAGATGTGCTTTGCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139176.2-278s1c1
Sequence:CCGGGCGACTGTGAACATCTTGGAACTCGAGTTCCAAGATGTTCACAGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139176.2-3176s1c1
Sequence:CCGGGAGGGTCACATGTTAACACTACTCGAGTAGTGTTAACATGTGACCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139176.2-3114s1c1
Sequence:CCGGGCTCTACGAATTACACAGGAACTCGAGTTCCTGTGTAATTCGTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139176.2-3143s1c1
Sequence:CCGGCGGGTCTCTAAGATGTCTTATCTCGAGATAAGACATCTTAGAGACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139176.2-218s1c1
Sequence:CCGGGATGGCAAGAAACTGGCAGAACTCGAGTTCTGCCAGTTTCTTGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139176.2-2905s1c1
Sequence:CCGGGAGTGGCATAATTAAGCTCTTCTCGAGAAGAGCTTAATTATGCCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139176.3-1982s21c1
Sequence:CCGGTTTGAACTGGACATTGAATTTCTCGAGAAATTCAATGTCCAGTTCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139176.3-1844s21c1
Sequence:CCGGCCGTTCAAGGAAATTTCTATTCTCGAGAATAGAAATTTCCTTGAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139176.2-532s1c1
Sequence:CCGGCCAACGGTTCATTCCATTCTTCTCGAGAAGAATGGAATGAACCGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139176.3-2253s21c1
Sequence:CCGGACCTGCTCAGAAATCATAAATCTCGAGATTTATGATTTCTGAGCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139176
NLRP7 MISSION shRNA shRNA Plasmid DNA
NLR family, pyrin domain containing 7
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000128829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139176.2-1723s1c1
Sequence:CCGGGCAATGCAAAGCACATCTTCACTCGAGTGAAGATGTGCTTTGCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139176.2-278s1c1
Sequence:CCGGGCGACTGTGAACATCTTGGAACTCGAGTTCCAAGATGTTCACAGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139176.2-3176s1c1
Sequence:CCGGGAGGGTCACATGTTAACACTACTCGAGTAGTGTTAACATGTGACCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139176.2-3114s1c1
Sequence:CCGGGCTCTACGAATTACACAGGAACTCGAGTTCCTGTGTAATTCGTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139176.2-3143s1c1
Sequence:CCGGCGGGTCTCTAAGATGTCTTATCTCGAGATAAGACATCTTAGAGACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139176.2-218s1c1
Sequence:CCGGGATGGCAAGAAACTGGCAGAACTCGAGTTCTGCCAGTTTCTTGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139176.2-2905s1c1
Sequence:CCGGGAGTGGCATAATTAAGCTCTTCTCGAGAAGAGCTTAATTATGCCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139176.3-1982s21c1
Sequence:CCGGTTTGAACTGGACATTGAATTTCTCGAGAAATTCAATGTCCAGTTCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139176.3-1844s21c1
Sequence:CCGGCCGTTCAAGGAAATTTCTATTCTCGAGAATAGAAATTTCCTTGAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139176.2-532s1c1
Sequence:CCGGCCAACGGTTCATTCCATTCTTCTCGAGAAGAATGGAATGAACCGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139176.3-2253s21c1
Sequence:CCGGACCTGCTCAGAAATCATAAATCTCGAGATTTATGATTTCTGAGCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139176
NLRP7 MISSION shRNA Lentiviral Transduction Particles
NLR family, pyrin domain containing 7
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000128829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139176.2-1723s1c1
Sequence:CCGGGCAATGCAAAGCACATCTTCACTCGAGTGAAGATGTGCTTTGCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139176.2-278s1c1
Sequence:CCGGGCGACTGTGAACATCTTGGAACTCGAGTTCCAAGATGTTCACAGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139176.2-3176s1c1
Sequence:CCGGGAGGGTCACATGTTAACACTACTCGAGTAGTGTTAACATGTGACCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139176.2-3114s1c1
Sequence:CCGGGCTCTACGAATTACACAGGAACTCGAGTTCCTGTGTAATTCGTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139176.2-3143s1c1
Sequence:CCGGCGGGTCTCTAAGATGTCTTATCTCGAGATAAGACATCTTAGAGACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139176.2-218s1c1
Sequence:CCGGGATGGCAAGAAACTGGCAGAACTCGAGTTCTGCCAGTTTCTTGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139176.2-2905s1c1
Sequence:CCGGGAGTGGCATAATTAAGCTCTTCTCGAGAAGAGCTTAATTATGCCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139176.3-1982s21c1
Sequence:CCGGTTTGAACTGGACATTGAATTTCTCGAGAAATTCAATGTCCAGTTCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139176.3-1844s21c1
Sequence:CCGGCCGTTCAAGGAAATTTCTATTCTCGAGAATAGAAATTTCCTTGAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139176.2-532s1c1
Sequence:CCGGCCAACGGTTCATTCCATTCTTCTCGAGAAGAATGGAATGAACCGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139176.3-2253s21c1
Sequence:CCGGACCTGCTCAGAAATCATAAATCTCGAGATTTATGATTTCTGAGCAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)