EMAIL THIS PAGE TO A FRIEND

NMB

neuromedin B

55 Gene Product Result for
UniProtKB ID: P08949, Q96A06, Q96HH5
Gene ID:
Mouse(68039) neuromedin B
Rat(499194) neuromedin B
sheep(101108605) neuromedin B
chicken(415333) neuromedin B
dog(479051) neuromedin B
cow(506584) neuromedin B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301059 ANTI-NMB (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021077 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026523 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026523 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026523 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021077 Rosetta Predictions human pricing
NM_205858 Rosetta Predictions human pricing
NM_001109149 Rosetta Predictions rat pricing
NM_026523 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354567 predicted 951
2 SASI_Hs01_00017914 predicted 665
3 SASI_Hs01_00017915 predicted 526
4 SASI_Hs01_00017917 predicted 679
5 SASI_Hs01_00017918 predicted 683
6 SASI_Hs01_00017919 predicted 945
7 SASI_Hs01_00017920 predicted 800
8 SASI_Hs01_00017921 predicted 681
9 SASI_Hs01_00017922 predicted 907
10 SASI_Hs01_00017923 predicted 951
11 SASI_Hs01_00017916 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373499 predicted 948
2 SASI_Hs01_00229398 predicted 667
3 SASI_Hs01_00229399 predicted 522
4 SASI_Hs01_00229401 predicted 682
5 SASI_Hs01_00229402 predicted 678
6 SASI_Hs01_00229403 predicted 940
7 SASI_Hs01_00229404 predicted 799
8 SASI_Hs01_00229405 predicted 682
9 SASI_Hs01_00229406 predicted 908
10 SASI_Hs01_00229407 predicted 947
11 SASI_Hs01_00229400 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245610 predicted 330
2 SASI_Rn02_00245611 predicted 311
3 SASI_Rn02_00245612 predicted 349
4 SASI_Rn02_00245613 predicted 210
5 SASI_Rn02_00245614 predicted 403
6 SASI_Rn02_00245615 predicted 249
7 SASI_Rn02_00245616 predicted 208
8 SASI_Rn02_00245617 predicted 306
9 SASI_Rn02_00245618 predicted 293
10 SASI_Rn02_00245619 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330435 predicted 321
2 SASI_Mm01_00156745 predicted 323
3 SASI_Mm02_00330436 predicted 402
4 SASI_Mm01_00156747 predicted 343
5 SASI_Mm01_00156748 predicted 313
6 SASI_Mm01_00156749 predicted 215
7 SASI_Mm01_00156750 predicted 335
8 SASI_Mm01_00156751 predicted 217
9 SASI_Mm01_00156752 predicted 353
10 SASI_Mm01_00156753 predicted 417
11 SASI_Mm01_00156744 predicted 395
12 SASI_Mm01_00156746 predicted 423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021077
VALIDATED
NMB MISSION shRNA Bacterial Glycerol Stock
neuromedin B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021077.3-876s1c1
Sequence:CCGGGATGTAAATCCTGAGCTCAAACTCGAGTTTGAGCTCAGGATTTACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021077.3-891s1c1
Sequence:CCGGCTCAAATCTCTGTTACTCCATCTCGAGATGGAGTAACAGAGATTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021077.3-762s1c1
Sequence:CCGGCTGGTACAAATACTGCAGAAACTCGAGTTTCTGCAGTATTTGTACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021077.3-671s1c1
Sequence:CCGGGAGTCATGATCTGCTCGGAATCTCGAGATTCCGAGCAGATCATGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_021077.3-843s21c1
Sequence:CCGGTGCTGAATGGGACCCTGTTGACTCGAGTCAACAGGGTCCCATTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021077.3-805s21c1
Sequence:CCGGACAACAGCGTGGCTTAGATTGCTCGAGCAATCTAAGCCACGCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021077.3-694s21c1
Sequence:CCGGTCCTGCTAAAGAAGGCTCTGGCTCGAGCCAGAGCCTTCTTTAGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021077.3-575s21c1
Sequence:CCGGCGGTCACTTCATGGGCAAGAACTCGAGTTCTTGCCCATGAAGTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021077
VALIDATED
NMB MISSION shRNA shRNA Plasmid DNA
neuromedin B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021077.3-876s1c1
Sequence:CCGGGATGTAAATCCTGAGCTCAAACTCGAGTTTGAGCTCAGGATTTACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021077.3-891s1c1
Sequence:CCGGCTCAAATCTCTGTTACTCCATCTCGAGATGGAGTAACAGAGATTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021077.3-762s1c1
Sequence:CCGGCTGGTACAAATACTGCAGAAACTCGAGTTTCTGCAGTATTTGTACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021077.3-671s1c1
Sequence:CCGGGAGTCATGATCTGCTCGGAATCTCGAGATTCCGAGCAGATCATGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_021077.3-843s21c1
Sequence:CCGGTGCTGAATGGGACCCTGTTGACTCGAGTCAACAGGGTCCCATTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021077.3-805s21c1
Sequence:CCGGACAACAGCGTGGCTTAGATTGCTCGAGCAATCTAAGCCACGCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021077.3-694s21c1
Sequence:CCGGTCCTGCTAAAGAAGGCTCTGGCTCGAGCCAGAGCCTTCTTTAGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021077.3-575s21c1
Sequence:CCGGCGGTCACTTCATGGGCAAGAACTCGAGTTCTTGCCCATGAAGTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021077
VALIDATED
NMB MISSION shRNA Lentiviral Transduction Particles
neuromedin B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021077.3-876s1c1
Sequence:CCGGGATGTAAATCCTGAGCTCAAACTCGAGTTTGAGCTCAGGATTTACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021077.3-891s1c1
Sequence:CCGGCTCAAATCTCTGTTACTCCATCTCGAGATGGAGTAACAGAGATTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021077.3-762s1c1
Sequence:CCGGCTGGTACAAATACTGCAGAAACTCGAGTTTCTGCAGTATTTGTACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021077.3-671s1c1
Sequence:CCGGGAGTCATGATCTGCTCGGAATCTCGAGATTCCGAGCAGATCATGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_021077.3-843s21c1
Sequence:CCGGTGCTGAATGGGACCCTGTTGACTCGAGTCAACAGGGTCCCATTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021077.3-805s21c1
Sequence:CCGGACAACAGCGTGGCTTAGATTGCTCGAGCAATCTAAGCCACGCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021077.3-694s21c1
Sequence:CCGGTCCTGCTAAAGAAGGCTCTGGCTCGAGCCAGAGCCTTCTTTAGCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021077.3-575s21c1
Sequence:CCGGCGGTCACTTCATGGGCAAGAACTCGAGTTCTTGCCCATGAAGTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026523
NMB MISSION shRNA Bacterial Glycerol Stock
neuromedin B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026523.1-456s1c1
Sequence:CCGGCTGGGCTTAGAATGTGTCCATCTCGAGATGGACACATTCTAAGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026523.1-302s1c1
Sequence:CCGGCAGAGACTACAGCTGAGTCATCTCGAGATGACTCAGCTGTAGTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026523.1-338s1c1
Sequence:CCGGCTCCTGCGAAAGAAAGCTCTACTCGAGTAGAGCTTTCTTTCGCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026523.1-343s1c1
Sequence:CCGGGCGAAAGAAAGCTCTAGGCATCTCGAGATGCCTAGAGCTTTCTTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026523.1-175s1c1
Sequence:CCGGAGCAAGCAAGATTCGAGTGCACTCGAGTGCACTCGAATCTTGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026523
NMB MISSION shRNA shRNA Plasmid DNA
neuromedin B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026523.1-456s1c1
Sequence:CCGGCTGGGCTTAGAATGTGTCCATCTCGAGATGGACACATTCTAAGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026523.1-302s1c1
Sequence:CCGGCAGAGACTACAGCTGAGTCATCTCGAGATGACTCAGCTGTAGTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026523.1-338s1c1
Sequence:CCGGCTCCTGCGAAAGAAAGCTCTACTCGAGTAGAGCTTTCTTTCGCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026523.1-343s1c1
Sequence:CCGGGCGAAAGAAAGCTCTAGGCATCTCGAGATGCCTAGAGCTTTCTTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026523.1-175s1c1
Sequence:CCGGAGCAAGCAAGATTCGAGTGCACTCGAGTGCACTCGAATCTTGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026523
NMB MISSION shRNA Lentiviral Transduction Particles
neuromedin B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026523.1-456s1c1
Sequence:CCGGCTGGGCTTAGAATGTGTCCATCTCGAGATGGACACATTCTAAGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026523.1-302s1c1
Sequence:CCGGCAGAGACTACAGCTGAGTCATCTCGAGATGACTCAGCTGTAGTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026523.1-338s1c1
Sequence:CCGGCTCCTGCGAAAGAAAGCTCTACTCGAGTAGAGCTTTCTTTCGCAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026523.1-343s1c1
Sequence:CCGGGCGAAAGAAAGCTCTAGGCATCTCGAGATGCCTAGAGCTTTCTTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026523.1-175s1c1
Sequence:CCGGAGCAAGCAAGATTCGAGTGCACTCGAGTGCACTCGAATCTTGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)