EMAIL THIS PAGE TO A FRIEND

NMD3

NMD3 ribosome export adaptor

87 Gene Product Result for
UniProtKB ID: Q96D46, D3DNM7, Q9Y2Z6
Gene ID:
Human(51068) Summary: Ribosomes are composed of 60S and 40S subunits that are assembled in the nucleolus and exported to the cytoplasm through nuclear pore complexes in the nuclear envelope. NMD3 is an adaptor for 60S subunit export via the CRM1 (XPO1; MIM 602559) pathway (Trotta et al., 2003 [PubMed 12773398]
Mouse(97112) NMD3 homolog (S. cerevisiae)
Rat(310512) NMD3 ribosome export adaptor
fruit fly(31195) Nonsense-mediated mRNA 3
Zebrafish(541444) NMD3 homolog (S. cerevisiae)
cow(509871) NMD3 homolog (S. cerevisiae)
Horse(100062312) NMD3 homolog (S. cerevisiae)
domestic cat(101082175) NMD3 homolog (S. cerevisiae)
dog(488137) NMD3 homolog (S. cerevisiae)
chicken(425009) NMD3 homolog (S. cerevisiae)
sheep(101104030) NMD3 homolog (S. cerevisiae)
naked mole-rat(101707382) NMD3 homolog (S. cerevisiae)
Domestic Rabbit(100354546) NMD3 homolog (S. cerevisiae)
domestic guinea pig(100733259) NMD3 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015938 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133787 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133787 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133787 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007061 MISSION® esiRNA esiRNA targeting human NMD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015938 Rosetta Predictions human pricing
NM_001107682 Rosetta Predictions rat pricing
XM_227253 Rosetta Predictions rat pricing
NM_133787 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100481 predicted 315
2 SASI_Hs01_00100482 predicted 471
3 SASI_Hs01_00100483 predicted 746
4 SASI_Hs01_00100484 predicted 1348
5 SASI_Hs01_00100485 predicted 584
6 SASI_Hs01_00100486 predicted 202
7 SASI_Hs01_00100487 predicted 538
8 SASI_Hs01_00100489 predicted 734
9 SASI_Hs01_00100490 predicted 794
10 SASI_Hs02_00348573 predicted 1484
11 SASI_Hs01_00100488 predicted 1460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231235 predicted 206
2 SASI_Rn02_00231236 predicted 466
3 SASI_Rn02_00231237 predicted 782
4 SASI_Rn02_00231238 predicted 996
5 SASI_Rn02_00231239 predicted 236
6 SASI_Rn02_00231240 predicted 835
7 SASI_Rn02_00231241 predicted 827
8 SASI_Rn02_00231242 predicted 514
9 SASI_Rn02_00231243 predicted 881
10 SASI_Rn02_00231244 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227253 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00190762 predicted 655
2 SASI_Rn01_00190763 predicted 528
3 SASI_Rn01_00190764 predicted 602
4 SASI_Rn01_00190765 predicted 635
5 SASI_Rn01_00190766 predicted 605
6 SASI_Rn01_00190767 predicted 661
7 SASI_Rn01_00190768 predicted 524
8 SASI_Rn01_00190769 predicted 647
9 SASI_Rn01_00190770 predicted 611
10 SASI_Rn01_00190771 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181257 predicted 1507
2 SASI_Mm02_00338812 predicted 460
3 SASI_Mm01_00181258 predicted 721
4 SASI_Mm01_00181259 predicted 588
5 SASI_Mm01_00181260 predicted 408
6 SASI_Mm01_00181262 predicted 1298
7 SASI_Mm01_00181263 predicted 762
8 SASI_Mm01_00181264 predicted 958
9 SASI_Mm01_00181265 predicted 638
10 SASI_Mm02_00338813 predicted 449
11 SASI_Mm01_00181261 predicted 1171
12 SASI_Mm01_00181266 predicted 1422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015938
NMD3 MISSION shRNA Bacterial Glycerol Stock
NMD3 ribosome export adaptor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015938.2-1701s1c1
Sequence:CCGGCTACTATCTTTGCCTCCAGATCTCGAGATCTGGAGGCAAAGATAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015938.2-493s1c1
Sequence:CCGGGCTATCCTTCAACAAGTGTTTCTCGAGAAACACTTGTTGAAGGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015938.2-1417s1c1
Sequence:CCGGGATACAGATGATGAAAGGCAACTCGAGTTGCCTTTCATCATCTGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015938.2-1569s1c1
Sequence:CCGGGATGCTTGAAGACCTTCATATCTCGAGATATGAAGGTCTTCAAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015938.2-1207s1c1
Sequence:CCGGCGTACTCATTTGGGACATCTTCTCGAGAAGATGTCCCAAATGAGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146393    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015938.2-2487s1c1
Sequence:CCGGCCAGCATGAAGATAATGGCTACTCGAGTAGCCATTATCTTCATGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015938.3-489s21c1
Sequence:CCGGGCTATCCTTCAACAAGTGTTTCTCGAGAAACACTTGTTGAAGGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015938.3-1203s21c1
Sequence:CCGGCGTACTCATTTGGGACATCTTCTCGAGAAGATGTCCCAAATGAGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015938.3-1697s21c1
Sequence:CCGGCTACTATCTTTGCCTCCAGATCTCGAGATCTGGAGGCAAAGATAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015938.3-1565s21c1
Sequence:CCGGGATGCTTGAAGACCTTCATATCTCGAGATATGAAGGTCTTCAAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015938
NMD3 MISSION shRNA shRNA Plasmid DNA
NMD3 ribosome export adaptor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015938.2-1701s1c1
Sequence:CCGGCTACTATCTTTGCCTCCAGATCTCGAGATCTGGAGGCAAAGATAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015938.2-493s1c1
Sequence:CCGGGCTATCCTTCAACAAGTGTTTCTCGAGAAACACTTGTTGAAGGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015938.2-1417s1c1
Sequence:CCGGGATACAGATGATGAAAGGCAACTCGAGTTGCCTTTCATCATCTGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015938.2-1569s1c1
Sequence:CCGGGATGCTTGAAGACCTTCATATCTCGAGATATGAAGGTCTTCAAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015938.2-1207s1c1
Sequence:CCGGCGTACTCATTTGGGACATCTTCTCGAGAAGATGTCCCAAATGAGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146393    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015938.2-2487s1c1
Sequence:CCGGCCAGCATGAAGATAATGGCTACTCGAGTAGCCATTATCTTCATGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015938.3-489s21c1
Sequence:CCGGGCTATCCTTCAACAAGTGTTTCTCGAGAAACACTTGTTGAAGGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015938.3-1203s21c1
Sequence:CCGGCGTACTCATTTGGGACATCTTCTCGAGAAGATGTCCCAAATGAGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015938.3-1697s21c1
Sequence:CCGGCTACTATCTTTGCCTCCAGATCTCGAGATCTGGAGGCAAAGATAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015938.3-1565s21c1
Sequence:CCGGGATGCTTGAAGACCTTCATATCTCGAGATATGAAGGTCTTCAAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015938
NMD3 MISSION shRNA Lentiviral Transduction Particles
NMD3 ribosome export adaptor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015938.2-1701s1c1
Sequence:CCGGCTACTATCTTTGCCTCCAGATCTCGAGATCTGGAGGCAAAGATAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015938.2-493s1c1
Sequence:CCGGGCTATCCTTCAACAAGTGTTTCTCGAGAAACACTTGTTGAAGGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015938.2-1417s1c1
Sequence:CCGGGATACAGATGATGAAAGGCAACTCGAGTTGCCTTTCATCATCTGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015938.2-1569s1c1
Sequence:CCGGGATGCTTGAAGACCTTCATATCTCGAGATATGAAGGTCTTCAAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015938.2-1207s1c1
Sequence:CCGGCGTACTCATTTGGGACATCTTCTCGAGAAGATGTCCCAAATGAGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146393    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015938.2-2487s1c1
Sequence:CCGGCCAGCATGAAGATAATGGCTACTCGAGTAGCCATTATCTTCATGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015938.3-489s21c1
Sequence:CCGGGCTATCCTTCAACAAGTGTTTCTCGAGAAACACTTGTTGAAGGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015938.3-1203s21c1
Sequence:CCGGCGTACTCATTTGGGACATCTTCTCGAGAAGATGTCCCAAATGAGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015938.3-1697s21c1
Sequence:CCGGCTACTATCTTTGCCTCCAGATCTCGAGATCTGGAGGCAAAGATAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015938.3-1565s21c1
Sequence:CCGGGATGCTTGAAGACCTTCATATCTCGAGATATGAAGGTCTTCAAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133787
NMD3 MISSION shRNA Bacterial Glycerol Stock
NMD3 ribosome export adaptor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133787.1-1223s1c1
Sequence:CCGGGCCAACTGTAACTTAAATGATCTCGAGATCATTTAAGTTACAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133787.1-821s1c1
Sequence:CCGGGTTCCAATATGCAAGGATAATCTCGAGATTATCCTTGCATATTGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133787.1-1018s1c1
Sequence:CCGGGCTCGAAGAGTTTATTGTGATCTCGAGATCACAATAAACTCTTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133787.1-1327s1c1
Sequence:CCGGCCGTAGAAACTGGAAACTGAACTCGAGTTCAGTTTCCAGTTTCTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133787.1-1019s1c1
Sequence:CCGGCTCGAAGAGTTTATTGTGATACTCGAGTATCACAATAAACTCTTCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133787.2-1327s21c1
Sequence:CCGGCCGTAGAAACTGGAAACTGAACTCGAGTTCAGTTTCCAGTTTCTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133787.2-821s21c1
Sequence:CCGGGTTCCAATATGCAAGGATAATCTCGAGATTATCCTTGCATATTGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133787.2-1223s21c1
Sequence:CCGGGCCAACTGTAACTTAAATGATCTCGAGATCATTTAAGTTACAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133787.2-1019s21c1
Sequence:CCGGCTCGAAGAGTTTATTGTGATACTCGAGTATCACAATAAACTCTTCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133787
NMD3 MISSION shRNA shRNA Plasmid DNA
NMD3 ribosome export adaptor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133787.1-1223s1c1
Sequence:CCGGGCCAACTGTAACTTAAATGATCTCGAGATCATTTAAGTTACAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133787.1-821s1c1
Sequence:CCGGGTTCCAATATGCAAGGATAATCTCGAGATTATCCTTGCATATTGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133787.1-1018s1c1
Sequence:CCGGGCTCGAAGAGTTTATTGTGATCTCGAGATCACAATAAACTCTTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133787.1-1327s1c1
Sequence:CCGGCCGTAGAAACTGGAAACTGAACTCGAGTTCAGTTTCCAGTTTCTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133787.1-1019s1c1
Sequence:CCGGCTCGAAGAGTTTATTGTGATACTCGAGTATCACAATAAACTCTTCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133787.2-1327s21c1
Sequence:CCGGCCGTAGAAACTGGAAACTGAACTCGAGTTCAGTTTCCAGTTTCTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133787.2-821s21c1
Sequence:CCGGGTTCCAATATGCAAGGATAATCTCGAGATTATCCTTGCATATTGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133787.2-1223s21c1
Sequence:CCGGGCCAACTGTAACTTAAATGATCTCGAGATCATTTAAGTTACAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133787.2-1019s21c1
Sequence:CCGGCTCGAAGAGTTTATTGTGATACTCGAGTATCACAATAAACTCTTCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133787
NMD3 MISSION shRNA Lentiviral Transduction Particles
NMD3 ribosome export adaptor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133787.1-1223s1c1
Sequence:CCGGGCCAACTGTAACTTAAATGATCTCGAGATCATTTAAGTTACAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133787.1-821s1c1
Sequence:CCGGGTTCCAATATGCAAGGATAATCTCGAGATTATCCTTGCATATTGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133787.1-1018s1c1
Sequence:CCGGGCTCGAAGAGTTTATTGTGATCTCGAGATCACAATAAACTCTTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133787.1-1327s1c1
Sequence:CCGGCCGTAGAAACTGGAAACTGAACTCGAGTTCAGTTTCCAGTTTCTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133787.1-1019s1c1
Sequence:CCGGCTCGAAGAGTTTATTGTGATACTCGAGTATCACAATAAACTCTTCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133787.2-1327s21c1
Sequence:CCGGCCGTAGAAACTGGAAACTGAACTCGAGTTCAGTTTCCAGTTTCTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133787.2-821s21c1
Sequence:CCGGGTTCCAATATGCAAGGATAATCTCGAGATTATCCTTGCATATTGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133787.2-1223s21c1
Sequence:CCGGGCCAACTGTAACTTAAATGATCTCGAGATCATTTAAGTTACAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133787.2-1019s21c1
Sequence:CCGGCTCGAAGAGTTTATTGTGATACTCGAGTATCACAATAAACTCTTCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)